16-31109268-TCCGCTCCGGCCCCTCCTGGGAC-T

Variant names:

• chr16-31109268-TCCGCTCCGGCCCCTCCTGGGAC-T
• NM_005881.4:c.50_71delTCCGGCCCCTCCTGGGACCCGC

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_Strong PM2 PP5_Moderate

The NM_005881.4(BCKDK):​c.50_71delTCCGGCCCCTCCTGGGACCCGC​(p.Leu17HisfsTer47) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: BCKDK NM_005881.4 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 2.90

Genes affected

BCKDK (HGNC:16902): (branched chain keto acid dehydrogenase kinase) The branched-chain alpha-ketoacid dehydrogenase complex (BCKD) is an important regulator of the valine, leucine, and isoleucine catabolic pathways. The protein encoded by this gene is found in the mitochondrion, where it phosphorylates and inactivates BCKD. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 4 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 16-31109268-TCCGCTCCGGCCCCTCCTGGGAC-T is Pathogenic according to our data. Variant chr16-31109268-TCCGCTCCGGCCCCTCCTGGGAC-T is described in ClinVar as [Pathogenic]. Clinvar id is 1285549.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
BCKDK	NM_005881.4	c.50_71delTCCGGCCCCTCCTGGGACCCGC	p.Leu17HisfsTer47	frameshift_variant	Exon 2 of 12	ENST00000219794.11	NP_005872.2
BCKDK	NM_001122957.4	c.50_71delTCCGGCCCCTCCTGGGACCCGC	p.Leu17HisfsTer47	frameshift_variant	Exon 2 of 11		NP_001116429.1
BCKDK	NM_001271926.3	c.50_71delTCCGGCCCCTCCTGGGACCCGC	p.Leu17HisfsTer47	frameshift_variant	Exon 2 of 10		NP_001258855.1
BCKDK	XM_017022859.2	c.50_71delTCCGGCCCCTCCTGGGACCCGC	p.Leu17HisfsTer47	frameshift_variant	Exon 2 of 12		XP_016878348.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
BCKDK	ENST00000219794.11	c.50_71delTCCGGCCCCTCCTGGGACCCGC	p.Leu17HisfsTer47	frameshift_variant	Exon 2 of 12	1	NM_005881.4	ENSP00000219794.6

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Branched-chain keto acid dehydrogenase kinase deficiency Pathogenic:1

Mar 16, 2021

Institute of Human Genetics, University of Leipzig Medical Center

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant was identified as homozygous. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr16-31120589;