16-48167586-TTCACGGATTGTGCGCTGGATCAGGGTG-T

Variant names:

• chr16-48167586-TTCACGGATTGTGCGCTGGATCAGGGTG-T
• rs387906296
• NM_001370497.1:c.3939_3965delCACCCTGATCCAGCGCACAATCCGTGA

Variant summary

Our verdict is Likely benign. The variant received -2 ACMG points: 2P and 4B. PM4 BS2

The NM_001370497.1(ABCC11):​c.3939_3965delCACCCTGATCCAGCGCACAATCCGTGA​(p.Asp1313_Arg1321del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000504 in 1,614,018 control chromosomes in the GnomAD database, including 12 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Affects (no stars).

• Frequency:
  • Genomes: 𝑓 0.00089 (2 hom., cov: 32)
  • Exomes 𝑓: 0.00046 (10 hom.)
• Consequence: ABCC11 NM_001370497.1 disruptive_inframe_deletion
• Clinical Significance: Affects no assertion criteria provided O:1
• Conservation: PhyloP100: 7.31
• Publications: 1 publications found

Genes affected

ABCC11 (HGNC:14639): (ATP binding cassette subfamily C member 11) The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This ABC full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. The product of this gene participates in physiological processes involving bile acids, conjugated steroids, and cyclic nucleotides. In addition, a SNP in this gene is responsible for determination of human earwax type. This gene and family member ABCC12 are determined to be derived by duplication and are both localized to chromosome 16q12.1. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]

ACMG classification

Our verdict: Likely_benign. The variant received -2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001370497.1.
• BS2: High AC in GnomAd4 at 136 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ABCC11	NM_001370497.1	c.3939_3965delCACCCTGATCCAGCGCACAATCCGTGA	p.Asp1313_Arg1321del	disruptive_inframe_deletion	Exon 29 of 30	ENST00000356608.7	NP_001357426.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ABCC11	ENST00000356608.7	c.3939_3965delCACCCTGATCCAGCGCACAATCCGTGA	p.Asp1313_Arg1321del	disruptive_inframe_deletion	Exon 29 of 30	1	NM_001370497.1	ENSP00000349017.2

Frequencies

GnomAD3 genomes AF: 0.000894 AC: 136 AN: 152146 Hom.: 2 Cov.: 32

Gnomad AFR AF: 0.000121

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00733

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00270

Gnomad SAS AF: 0.000207

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000441

Gnomad OTH AF: 0.000478

GnomAD2 exomes AF: 0.00110 AC: 275 AN: 250900 AF XY: 0.000877

Gnomad AFR exome AF: 0.000123

Gnomad AMR exome AF: 0.00707

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00120

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000879

Gnomad OTH exome AF: 0.00147

GnomAD4 exome AF: 0.000463 AC: 677 AN: 1461754 Hom.: 10 AF XY: 0.000415 AC XY: 302 AN XY: 727200

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.000119 AC: 4 AN: 33476

American (AMR) AF: 0.0126 AC: 560 AN: 44598

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00179 AC: 71 AN: 39696

South Asian (SAS) AF: 0.000139 AC: 12 AN: 86258

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53420

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00000809 AC: 9 AN: 1112008

Other (OTH) AF: 0.000348 AC: 21 AN: 60394

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.000893 AC: 136 AN: 152264 Hom.: 2 Cov.: 32 AF XY: 0.00101 AC XY: 75 AN XY: 74468

African (AFR) AF: 0.000120 AC: 5 AN: 41554

American (AMR) AF: 0.00732 AC: 112 AN: 15294

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00271 AC: 14 AN: 5172

South Asian (SAS) AF: 0.000207 AC: 1 AN: 4820

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10624

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.0000441 AC: 3 AN: 68014

Other (OTH) AF: 0.000473 AC: 1 AN: 2112

Alfa AF: 0.000174 Hom.: 0

Bravo AF: 0.00146

ClinVar

Significance: Affects

Submissions summary: Other:1

Revision: no assertion criteria provided

Submissions by phenotype

APOCRINE GLAND SECRETION, VARIATION IN Other:1

Mar 01, 2006

OMIM

Significance: Affects

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.3
Mutation Taster		=182/18	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs387906296; hg19: chr16-48201497;