chr16-48167586-TTCACGGATTGTGCGCTGGATCAGGGTG-T

Position:

• chr16-48167586-TTCACGGATTGTGCGCTGGATCAGGGTG-T

Variant summary

Our verdict is Likely benign. Variant got -2 ACMG points: 2P and 4B. PM4 BS2

The NM_001370497.1(ABCC11):​c.3939_3965delCACCCTGATCCAGCGCACAATCCGTGA​(p.Asp1313_Arg1321del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000504 in 1,614,018 control chromosomes in the GnomAD database, including 12 homozygotes. Variant has been reported in ClinVar as Affects (no stars).

• Frequency:
  • Genomes: 𝑓 0.00089 (2 hom., cov: 32)
  • Exomes 𝑓: 0.00046 (10 hom.)
• Consequence: ABCC11 NM_001370497.1 disruptive_inframe_deletion
• Clinical Significance: Affects no assertion criteria provided O:1
• Conservation: PhyloP100: 7.31

Genes affected

ABCC11 (HGNC:14639): (ATP binding cassette subfamily C member 11) The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This ABC full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. The product of this gene participates in physiological processes involving bile acids, conjugated steroids, and cyclic nucleotides. In addition, a SNP in this gene is responsible for determination of human earwax type. This gene and family member ABCC12 are determined to be derived by duplication and are both localized to chromosome 16q12.1. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]

ABCC11 (HGNC:):

ACMG classification

Verdict is Likely_benign. Variant got -2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001370497.1.
• BS2: High AC in GnomAd4 at 136 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ABCC11	NM_001370497.1	c.3939_3965delCACCCTGATCCAGCGCACAATCCGTGA	p.Asp1313_Arg1321del	disruptive_inframe_deletion	29/30	ENST00000356608.7	NP_001357426.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ABCC11	ENST00000356608.7	c.3939_3965delCACCCTGATCCAGCGCACAATCCGTGA	p.Asp1313_Arg1321del	disruptive_inframe_deletion	29/30	1	NM_001370497.1	ENSP00000349017.2

Frequencies

GnomAD3 genomes AF: 0.000894 AC: 136 AN: 152146 Hom.: 2 Cov.: 32

Gnomad AFR AF: 0.000121

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00733

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00270

Gnomad SAS AF: 0.000207

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000441

Gnomad OTH AF: 0.000478

GnomAD4 exome AF: 0.000463 AC: 677 AN: 1461754 Hom.: 10 AF XY: 0.000415 AC XY: 302 AN XY: 727200

Gnomad4 AFR exome AF: 0.000119

Gnomad4 AMR exome AF: 0.0126

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00179

Gnomad4 SAS exome AF: 0.000139

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000809

Gnomad4 OTH exome AF: 0.000348

GnomAD4 genome AF: 0.000893 AC: 136 AN: 152264 Hom.: 2 Cov.: 32 AF XY: 0.00101 AC XY: 75 AN XY: 74468

Gnomad4 AFR AF: 0.000120

Gnomad4 AMR AF: 0.00732

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00271

Gnomad4 SAS AF: 0.000207

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000441

Gnomad4 OTH AF: 0.000473

Alfa AF: 0.000174 Hom.: 0

Bravo AF: 0.00146

ClinVar

Significance: Affects

Submissions summary: Other:1

Revision: no assertion criteria provided

Submissions by phenotype

APOCRINE GLAND SECRETION, VARIATION IN Other:1

Affects, no assertion criteria provided

literature only

OMIM

Mar 01, 2006

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs387906296; hg19: chr16-48201497;