16-57628963-AGTGTGAGTGTGTGAGAGTGAGTGAGAATGTGAGTGT-A

Position:

• chr16-57628963-AGTGTGAGTGTGTGAGAGTGAGTGAGAATGTGAGTGT-A

Variant summary

Our verdict is Benign. Variant got -10 ACMG points: 0P and 10B. BP6_Moderate BA1

The NM_201525.4(ADGRG1):​c.-36+163_-36+198delTGTGAGTGTGTGAGAGTGAGTGAGAATGTGAGTGTG variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0171 in 592,176 control chromosomes in the GnomAD database, including 606 homozygotes. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.062 (389 hom., cov: 25)
  • Exomes 𝑓: 0.0062 (217 hom.)
• Consequence: ADGRG1 NM_201525.4 intron
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.566

Genes affected

ADGRG1 (HGNC:4512): (adhesion G protein-coupled receptor G1) This gene encodes a member of the G protein-coupled receptor family and regulates brain cortical patterning. The encoded protein binds specifically to transglutaminase 2, a component of tissue and tumor stroma implicated as an inhibitor of tumor progression. Mutations in this gene are associated with a brain malformation known as bilateral frontoparietal polymicrogyria. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]

ADGRG1 (HGNC:):

ACMG classification

Verdict is Benign. Variant got -10 ACMG points.

• BP6: Variant 16-57628963-AGTGTGAGTGTGTGAGAGTGAGTGAGAATGTGAGTGT-A is Benign according to our data. Variant chr16-57628963-AGTGTGAGTGTGTGAGAGTGAGTGAGAATGTGAGTGT-A is described in ClinVar as [Benign]. Clinvar id is 1260783.Status of the report is criteria_provided_single_submitter, 1 stars.
• BA1: GnomAd4 highest subpopulation (EAS) allele frequency at 95% confidence interval = 0.19 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ADGRG1	NM_201525.4	c.-36+163_-36+198delTGTGAGTGTGTGAGAGTGAGTGAGAATGTGAGTGTG		intron_variant		ENST00000562631.7	NP_958933.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ADGRG1	ENST00000562631.7	c.-36+163_-36+198delTGTGAGTGTGTGAGAGTGAGTGAGAATGTGAGTGTG		intron_variant		1	NM_201525.4	ENSP00000455351.2

Frequencies

GnomAD3 genomes AF: 0.0616 AC: 7198 AN: 116780 Hom.: 386 Cov.: 25

Gnomad AFR AF: 0.130

Gnomad AMI AF: 0.0391

Gnomad AMR AF: 0.0855

Gnomad ASJ AF: 0.00617

Gnomad EAS AF: 0.201

Gnomad SAS AF: 0.0392

Gnomad FIN AF: 0.0278

Gnomad MID AF: 0.0297

Gnomad NFE AF: 0.0163

Gnomad OTH AF: 0.0545

GnomAD4 exome AF: 0.00615 AC: 2924 AN: 475270 Hom.: 217 AF XY: 0.00611 AC XY: 1359 AN XY: 222260

Gnomad4 AFR exome AF: 0.0669

Gnomad4 AMR exome AF: 0.0226

Gnomad4 ASJ exome AF: 0.00100

Gnomad4 EAS exome AF: 0.0713

Gnomad4 SAS exome AF: 0.0117

Gnomad4 FIN exome AF: 0.00556

Gnomad4 NFE exome AF: 0.00444

Gnomad4 OTH exome AF: 0.0115

GnomAD4 genome AF: 0.0618 AC: 7228 AN: 116906 Hom.: 389 Cov.: 25 AF XY: 0.0629 AC XY: 3591 AN XY: 57126

Gnomad4 AFR AF: 0.130

Gnomad4 AMR AF: 0.0861

Gnomad4 ASJ AF: 0.00617

Gnomad4 EAS AF: 0.201

Gnomad4 SAS AF: 0.0389

Gnomad4 FIN AF: 0.0278

Gnomad4 NFE AF: 0.0163

Gnomad4 OTH AF: 0.0597

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Benign, criteria provided, single submitter

clinical testing

GeneDx

Feb 24, 2021

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs879809999; hg19: chr16-57662875;