16-67195890-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant names:

• chr16-67195890-A-ACAGCAGCAGCAGCAGCAGCAG
• rs3830472
• NM_001950.4:c.938_958dupGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2

The NM_001950.4(E2F4):​c.938_958dupGCAGCAGCAGCAGCAGCAGCA​(p.Ser313_Ser319dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000465 in 150,446 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000047 (0 hom., cov: 31)
  • Exomes 𝑓: 0.000042 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: E2F4 NM_001950.4 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 2.01

Genes affected

E2F4 (HGNC:3118): (E2F transcription factor 4) The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein binds to all three of the tumor suppressor proteins pRB, p107 and p130, but with higher affinity to the last two. It plays an important role in the suppression of proliferation-associated genes, and its gene mutation and increased expression may be associated with human cancer. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS2: High AC in GnomAd4 at 7 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
E2F4	NM_001950.4	c.938_958dupGCAGCAGCAGCAGCAGCAGCA	p.Ser313_Ser319dup	disruptive_inframe_insertion	Exon 7 of 10	ENST00000379378.8	NP_001941.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
E2F4	ENST00000379378.8	c.938_958dupGCAGCAGCAGCAGCAGCAGCA	p.Ser313_Ser319dup	disruptive_inframe_insertion	Exon 7 of 10	1	NM_001950.4	ENSP00000368686.3

Frequencies

GnomAD3 genomes AF: 0.0000466 AC: 7 AN: 150350 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.0000737

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000662

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000389

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000148

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000418 AC: 61 AN: 1457606 Hom.: 0 Cov.: 30 AF XY: 0.0000524 AC XY: 38 AN XY: 725026

Gnomad4 AFR exome AF: 0.0000912

Gnomad4 AMR exome AF: 0.0000224

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000304

Gnomad4 SAS exome AF: 0.000152

Gnomad4 FIN exome AF: 0.0000566

Gnomad4 NFE exome AF: 0.0000216

Gnomad4 OTH exome AF: 0.0000666

GnomAD4 genome AF: 0.0000465 AC: 7 AN: 150446 Hom.: 0 Cov.: 31 AF XY: 0.0000272 AC XY: 2 AN XY: 73442

Gnomad4 AFR AF: 0.0000735

Gnomad4 AMR AF: 0.0000661

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000390

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000148

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs3830472; hg19: chr16-67229793;