chr16-67195890-A-ACAGCAGCAGCAGCAGCAGCAG

Variant names:

• chr16-67195890-A-ACAGCAGCAGCAGCAGCAGCAG
• rs3830472
• NM_001950.4:c.938_958dupGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3 BS2

The NM_001950.4(E2F4):​c.938_958dupGCAGCAGCAGCAGCAGCAGCA​(p.Ser313_Ser319dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000465 in 150,446 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000047 (0 hom., cov: 31)
  • Exomes 𝑓: 0.000042 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: E2F4 NM_001950.4 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 2.01
• Publications: 11 publications found

Genes affected

E2F4 (HGNC:3118): (E2F transcription factor 4) The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein binds to all three of the tumor suppressor proteins pRB, p107 and p130, but with higher affinity to the last two. It plays an important role in the suppression of proliferation-associated genes, and its gene mutation and increased expression may be associated with human cancer. [provided by RefSeq, Jul 2008]

ACMG classification

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001950.4
• BS2: High AC in GnomAd4 at 7 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001950.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	E2F4	NM_001950.4	MANE Select	c.938_958dupGCAGCAGCAGCAGCAGCAGCA	p.Ser313_Ser319dup	disruptive_inframe_insertion	Exon 7 of 10	NP_001941.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	E2F4	ENST00000379378.8	TSL:1 MANE Select	c.938_958dupGCAGCAGCAGCAGCAGCAGCA	p.Ser313_Ser319dup	disruptive_inframe_insertion	Exon 7 of 10	ENSP00000368686.3	Q16254
	E2F4	ENST00000914909.1		c.938_958dupGCAGCAGCAGCAGCAGCAGCA	p.Ser313_Ser319dup	disruptive_inframe_insertion	Exon 7 of 10	ENSP00000584968.1
	E2F4	ENST00000957228.1		c.953_973dupGCAGCAGCAGCAGCAGCAGCA	p.Ser318_Ser324dup	disruptive_inframe_insertion	Exon 7 of 10	ENSP00000627287.1

Frequencies

GnomAD3 genomes AF: 0.0000466 AC: 7 AN: 150350 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.0000737

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000662

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000389

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000148

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000418 AC: 61 AN: 1457606 Hom.: 0 Cov.: 30 AF XY: 0.0000524 AC XY: 38 AN XY: 725026

African (AFR) AF: 0.0000912 AC: 3 AN: 32892

American (AMR) AF: 0.0000224 AC: 1 AN: 44574

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26076

East Asian (EAS) AF: 0.000304 AC: 12 AN: 39530

South Asian (SAS) AF: 0.000152 AC: 13 AN: 85722

European-Finnish (FIN) AF: 0.0000566 AC: 3 AN: 53048

Middle Eastern (MID) AF: 0.000175 AC: 1 AN: 5730

European-Non Finnish (NFE) AF: 0.0000216 AC: 24 AN: 1109930

Other (OTH) AF: 0.0000666 AC: 4 AN: 60104

GnomAD4 genome AF: 0.0000465 AC: 7 AN: 150446 Hom.: 0 Cov.: 31 AF XY: 0.0000272 AC XY: 2 AN XY: 73442

African (AFR) AF: 0.0000735 AC: 3 AN: 40830

American (AMR) AF: 0.0000661 AC: 1 AN: 15118

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3464

East Asian (EAS) AF: 0.000390 AC: 2 AN: 5132

South Asian (SAS) AF: 0.00 AC: 0 AN: 4774

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10260

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.0000148 AC: 1 AN: 67572

Other (OTH) AF: 0.00 AC: 0 AN: 2092

Alfa AF: 0.00 Hom.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.0
Mutation Taster		=75/25	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3830472; hg19: chr16-67229793;