16-87604287-C-CCTGCTGCTGCTGCTGCTGCTGCTGCTG

Position:

• chr16-87604287-C-CCTGCTGCTGCTGCTGCTGCTGCTGCTG

Variant summary

Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BP3 BS2

The NM_001271604.4(JPH3):​c.446_472dupCTGCTGCTGCTGCTGCTGCTGCTGCTG​(p.Ala149_Ala157dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00013 in 1,432,886 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00032 (0 hom., cov: 0)
  • Exomes 𝑓: 0.00011 (0 hom.)
• Consequence: JPH3 NM_001271604.4 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.966

Genes affected

JPH3 (HGNC:14203): (junctophilin 3) Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. CAG/CTG repeat expansion from normally 6-28 repeats to 40-59 repeats in the 3' UTR of this gene have been associated with Huntington disease-like 2 (HDL2). This gene is a member of the junctophilin gene family. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2016]

JPH3 (HGNC:):

ACMG classification

Verdict is Likely_benign. Variant got -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001271604.4
• BS2: High AC in GnomAd4 at 48 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
JPH3	NM_020655.4	c.382+775_382+801dupCTGCTGCTGCTGCTGCTGCTGCTGCTG		intron_variant		ENST00000284262.3	NP_065706.2
JPH3	NM_001271604.4	c.446_472dupCTGCTGCTGCTGCTGCTGCTGCTGCTG	p.Ala149_Ala157dup	disruptive_inframe_insertion	2/2		NP_001258533.1
JPH3	NM_001271605.3	c.*144_*170dupCTGCTGCTGCTGCTGCTGCTGCTGCTG		3_prime_UTR_variant	2/2		NP_001258534.1
JPH3	NR_073379.3	n.96+2373_96+2399dupCTGCTGCTGCTGCTGCTGCTGCTGCTG		intron_variant

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
JPH3	ENST00000284262.3	c.382+775_382+801dupCTGCTGCTGCTGCTGCTGCTGCTGCTG		intron_variant		1	NM_020655.4	ENSP00000284262.2
JPH3	ENST00000301008.5	n.706_732dupCTGCTGCTGCTGCTGCTGCTGCTGCTG		non_coding_transcript_exon_variant	2/2	1
JPH3	ENST00000537256.5	n.96+2373_96+2399dupCTGCTGCTGCTGCTGCTGCTGCTGCTG		intron_variant		2

Frequencies

GnomAD3 genomes AF: 0.000320 AC: 48 AN: 149956 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000542

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000198

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000212

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000326

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.000108 AC: 138 AN: 1282822 Hom.: 0 Cov.: 30 AF XY: 0.000109 AC XY: 69 AN XY: 632998

Gnomad4 AFR exome AF: 0.000318

Gnomad4 AMR exome AF: 0.000340

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000249

Gnomad4 SAS exome AF: 0.0000128

Gnomad4 FIN exome AF: 0.000102

Gnomad4 NFE exome AF: 0.000102

Gnomad4 OTH exome AF: 0.0000979

GnomAD4 genome AF: 0.000320 AC: 48 AN: 150064 Hom.: 0 Cov.: 0 AF XY: 0.000382 AC XY: 28 AN XY: 73220

Gnomad4 AFR AF: 0.000541

Gnomad4 AMR AF: 0.000198

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.000212

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000326

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs71156237; hg19: chr16-87637893;