NM_020655.4:c.382+775_382+801dupCTGCTGCTGCTGCTGCTGCTGCTGCTG
Variant summary
Our verdict is Likely benign. The variant received -4 ACMG points: 0P and 4B. BS2
The NM_020655.4(JPH3):c.382+775_382+801dupCTGCTGCTGCTGCTGCTGCTGCTGCTG variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00013 in 1,432,886 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_020655.4 intron
Scores
Clinical Significance
Conservation
Publications
- Huntington disease-like 2Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_020655.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| JPH3 | NM_020655.4 | MANE Select | c.382+775_382+801dupCTGCTGCTGCTGCTGCTGCTGCTGCTG | intron | N/A | NP_065706.2 | |||
| JPH3 | NM_001271604.4 | c.446_472dupCTGCTGCTGCTGCTGCTGCTGCTGCTG | p.Ala149_Ala157dup | disruptive_inframe_insertion | Exon 2 of 2 | NP_001258533.1 | |||
| JPH3 | NM_001271605.3 | c.*144_*170dupCTGCTGCTGCTGCTGCTGCTGCTGCTG | 3_prime_UTR | Exon 2 of 2 | NP_001258534.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| JPH3 | ENST00000284262.3 | TSL:1 MANE Select | c.382+775_382+801dupCTGCTGCTGCTGCTGCTGCTGCTGCTG | intron | N/A | ENSP00000284262.2 | |||
| JPH3 | ENST00000301008.5 | TSL:1 | n.706_732dupCTGCTGCTGCTGCTGCTGCTGCTGCTG | non_coding_transcript_exon | Exon 2 of 2 | ||||
| JPH3 | ENST00000537256.5 | TSL:2 | n.96+2373_96+2399dupCTGCTGCTGCTGCTGCTGCTGCTGCTG | intron | N/A |
Frequencies
GnomAD3 genomes AF: 0.000320 AC: 48AN: 149956Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome AF: 0.000108 AC: 138AN: 1282822Hom.: 0 Cov.: 30 AF XY: 0.000109 AC XY: 69AN XY: 632998 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000320 AC: 48AN: 150064Hom.: 0 Cov.: 0 AF XY: 0.000382 AC XY: 28AN XY: 73220 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at