16-88643507-C-CCGATCTGCGGCCGCTCCCGGGGCTTGGGCTCGATGGGCGTCCACTGCT
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_000101.4(CYBA):c.386_433dupAGCAGTGGACGCCCATCGAGCCCAAGCCCCGGGAGCGGCCGCAGATCG(p.Glu129_Ile144dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_000101.4 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- granulomatous disease, chronic, autosomal recessive, cytochrome b-negativeInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
- chronic granulomatous diseaseInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
CYBA | NM_000101.4 | c.386_433dupAGCAGTGGACGCCCATCGAGCCCAAGCCCCGGGAGCGGCCGCAGATCG | p.Glu129_Ile144dup | conservative_inframe_insertion | Exon 6 of 6 | ENST00000261623.8 | NP_000092.2 | |
CYBA | XM_011522905.4 | c.*1611_*1658dupAGCAGTGGACGCCCATCGAGCCCAAGCCCCGGGAGCGGCCGCAGATCG | 3_prime_UTR_variant | Exon 6 of 6 | XP_011521207.1 |
Ensembl
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome Cov.: 37
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Granulomatous disease, chronic, autosomal recessive, cytochrome b-negative Uncertain:1
This variant, c.386_433dup, results in the insertion of 16 amino acid(s) of the CYBA protein (p.Glu129_Ile144dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with CYBA-related conditions. ClinVar contains an entry for this variant (Variation ID: 466303). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at