16-88643507-C-CCGATCTGCGGCCGCTCCCGGGGCTTGGGCTCGATGGGCGTCCACTGCT

Position:

• chr16-88643507-C-CCGATCTGCGGCCGCTCCCGGGGCTTGGGCTCGATGGGCGTCCACTGCT

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_000101.4(CYBA):​c.386_433dupAGCAGTGGACGCCCATCGAGCCCAAGCCCCGGGAGCGGCCGCAGATCG​(p.Glu129_Ile144dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: CYBA NM_000101.4 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.80

Genes affected

CYBA (HGNC:2577): (cytochrome b-245 alpha chain) Cytochrome b is comprised of a light chain (alpha) and a heavy chain (beta). This gene encodes the light, alpha subunit which has been proposed as a primary component of the microbicidal oxidase system of phagocytes. Mutations in this gene are associated with autosomal recessive chronic granulomatous disease (CGD), that is characterized by the failure of activated phagocytes to generate superoxide, which is important for the microbicidal activity of these cells. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000101.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CYBA	NM_000101.4	c.386_433dupAGCAGTGGACGCCCATCGAGCCCAAGCCCCGGGAGCGGCCGCAGATCG	p.Glu129_Ile144dup	conservative_inframe_insertion	6/6	ENST00000261623.8	NP_000092.2
CYBA	XM_011522905.4	c.*1611_*1658dupAGCAGTGGACGCCCATCGAGCCCAAGCCCCGGGAGCGGCCGCAGATCG		3_prime_UTR_variant	6/6		XP_011521207.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CYBA	ENST00000261623.8	c.386_433dupAGCAGTGGACGCCCATCGAGCCCAAGCCCCGGGAGCGGCCGCAGATCG	p.Glu129_Ile144dup	conservative_inframe_insertion	6/6	1	NM_000101.4	ENSP00000261623.3

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 37

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Granulomatous disease, chronic, autosomal recessive, cytochrome b-negative Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Sep 07, 2022

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. ClinVar contains an entry for this variant (Variation ID: 466303). This variant has not been reported in the literature in individuals affected with CYBA-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant, c.386_433dup, results in the insertion of 16 amino acid(s) of the CYBA protein (p.Glu129_Ile144dup), but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555540977; hg19: chr16-88709915;