16-88643507-C-CCGATCTGCGGCCGCTCCCGGGGCTTGGGCTCGATGGGCGTCCACTGCT

Variant names:

• chr16-88643507-C-CCGATCTGCGGCCGCTCCCGGGGCTTGGGCTCGATGGGCGTCCACTGCT
• rs1555540977
• NM_000101.4:c.386_433dupAGCAGTGGACGCCCATCGAGCCCAAGCCCCGGGAGCGGCCGCAGATCG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_000101.4(CYBA):​c.386_433dupAGCAGTGGACGCCCATCGAGCCCAAGCCCCGGGAGCGGCCGCAGATCG​(p.Glu129_Ile144dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: CYBA NM_000101.4 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.80
• Publications: 0 publications found

Genes affected

CYBA (HGNC:2577): (cytochrome b-245 alpha chain) Cytochrome b is comprised of a light chain (alpha) and a heavy chain (beta). This gene encodes the light, alpha subunit which has been proposed as a primary component of the microbicidal oxidase system of phagocytes. Mutations in this gene are associated with autosomal recessive chronic granulomatous disease (CGD), that is characterized by the failure of activated phagocytes to generate superoxide, which is important for the microbicidal activity of these cells. [provided by RefSeq, Jul 2008]

CYBA Gene-Disease associations (from GenCC):

• granulomatous disease, chronic, autosomal recessive, cytochrome b-negative

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
• chronic granulomatous disease

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000101.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CYBA	NM_000101.4	c.386_433dupAGCAGTGGACGCCCATCGAGCCCAAGCCCCGGGAGCGGCCGCAGATCG	p.Glu129_Ile144dup	conservative_inframe_insertion	Exon 6 of 6	ENST00000261623.8	NP_000092.2
CYBA	XM_011522905.4	c.*1611_*1658dupAGCAGTGGACGCCCATCGAGCCCAAGCCCCGGGAGCGGCCGCAGATCG		3_prime_UTR_variant	Exon 6 of 6		XP_011521207.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CYBA	ENST00000261623.8	c.386_433dupAGCAGTGGACGCCCATCGAGCCCAAGCCCCGGGAGCGGCCGCAGATCG	p.Glu129_Ile144dup	conservative_inframe_insertion	Exon 6 of 6	1	NM_000101.4	ENSP00000261623.3

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 37

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Granulomatous disease, chronic, autosomal recessive, cytochrome b-negative Uncertain:1

Oct 21, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.386_433dup, results in the insertion of 16 amino acid(s) of the CYBA protein (p.Glu129_Ile144dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with CYBA-related conditions. ClinVar contains an entry for this variant (Variation ID: 466303). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.8

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555540977; hg19: chr16-88709915;