NM_000101.4:c.386_433dupAGCAGTGGACGCCCATCGAGCCCAAGCCCCGGGAGCGGCCGCAGATCG
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_000101.4(CYBA):c.386_433dupAGCAGTGGACGCCCATCGAGCCCAAGCCCCGGGAGCGGCCGCAGATCG(p.Glu129_Ile144dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_000101.4 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- granulomatous disease, chronic, autosomal recessive, cytochrome b-negativeInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
- chronic granulomatous diseaseInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000101.4. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CYBA | TSL:1 MANE Select | c.386_433dupAGCAGTGGACGCCCATCGAGCCCAAGCCCCGGGAGCGGCCGCAGATCG | p.Glu129_Ile144dup | conservative_inframe_insertion | Exon 6 of 6 | ENSP00000261623.3 | P13498 | ||
| CYBA | c.434_481dupAGCAGTGGACGCCCATCGAGCCCAAGCCCCGGGAGCGGCCGCAGATCG | p.Glu145_Ile160dup | conservative_inframe_insertion | Exon 7 of 7 | ENSP00000637672.1 | ||||
| CYBA | c.413_460dupAGCAGTGGACGCCCATCGAGCCCAAGCCCCGGGAGCGGCCGCAGATCG | p.Glu138_Ile153dup | conservative_inframe_insertion | Exon 7 of 7 | ENSP00000512450.1 | A0A8Q3WL20 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome Cov.: 37
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.