17-11598539-A-ACGCGGATGGGGAACCCGGCGCCGAC

Variant names:

• chr17-11598539-A-ACGCGGATGGGGAACCCGGCGCCGAC
• rs761517350
• NM_001372.4:c.44_68dupCGGATGGGGAACCCGGCGCCGACCG

Variant summary

Our verdict is Benign. Variant got -12 ACMG points: 4P and 16B. PVS1_Strong BP6_Very_Strong BS1 BS2

The NM_001372.4(DNAH9):​c.44_68dupCGGATGGGGAACCCGGCGCCGACCG​(p.Arg24GlyfsTer36) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0253 in 1,404,952 control chromosomes in the GnomAD database, including 589 homozygotes. Variant has been reported in ClinVar as Benign (★★).

• Frequency:
  • Genomes: 𝑓 0.022 (60 hom., cov: 31)
  • Exomes 𝑓: 0.026 (529 hom.)
• Consequence: DNAH9 NM_001372.4 frameshift
• Clinical Significance: Benign criteria provided, multiple submitters, no conflicts B:3
• Conservation: PhyloP100: -0.735

Genes affected

DNAH9 (HGNC:2953): (dynein axonemal heavy chain 9) This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Benign. Variant got -12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 8 pathogenic variants in the truncated region.
• BP6: Variant 17-11598539-A-ACGCGGATGGGGAACCCGGCGCCGAC is Benign according to our data. Variant chr17-11598539-A-ACGCGGATGGGGAACCCGGCGCCGAC is described in ClinVar as [Benign]. Clinvar id is 774512.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population nfe. gnomad4 allele frequency = 0.0224 (3404/152144) while in subpopulation NFE AF= 0.0286 (1947/67968). AF 95% confidence interval is 0.0276. There are 60 homozygotes in gnomad4. There are 1777 alleles in male gnomad4 subpopulation. Median coverage is 31. This position pass quality control queck.
• BS2: High Homozygotes in GnomAd4 at 60 AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
DNAH9	NM_001372.4	c.44_68dupCGGATGGGGAACCCGGCGCCGACCG	p.Arg24GlyfsTer36	frameshift_variant	Exon 1 of 69	ENST00000262442.9	NP_001363.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
DNAH9	ENST00000262442.9	c.44_68dupCGGATGGGGAACCCGGCGCCGACCG	p.Arg24GlyfsTer36	frameshift_variant	Exon 1 of 69	1	NM_001372.4	ENSP00000262442.3
DNAH9	ENST00000579406.1	n.71_95dupCGGATGGGGAACCCGGCGCCGACCG		non_coding_transcript_exon_variant	Exon 1 of 8	1
DNAH9	ENST00000454412.6	c.44_68dupCGGATGGGGAACCCGGCGCCGACCG	p.Arg24GlyfsTer36	frameshift_variant	Exon 1 of 68	5		ENSP00000414874.2
DNAH9	ENST00000579828.5	c.44_68dupCGGATGGGGAACCCGGCGCCGACCG	p.Arg24GlyfsTer36	frameshift_variant	Exon 1 of 4	2		ENSP00000463782.1

Frequencies

GnomAD3 genomes AF: 0.0224 AC: 3406 AN: 152032 Hom.: 60 Cov.: 31

Gnomad AFR AF: 0.00531

Gnomad AMI AF: 0.123

Gnomad AMR AF: 0.0234

Gnomad ASJ AF: 0.00951

Gnomad EAS AF: 0.000194

Gnomad SAS AF: 0.0158

Gnomad FIN AF: 0.0575

Gnomad MID AF: 0.0159

Gnomad NFE AF: 0.0286

Gnomad OTH AF: 0.0225

GnomAD3 exomes AF: 0.00162 AC: 48 AN: 29620 Hom.: 1 AF XY: 0.00185 AC XY: 32 AN XY: 17272

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.000669

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00160

Gnomad FIN exome AF: 0.00400

Gnomad NFE exome AF: 0.00233

Gnomad OTH exome AF: 0.00243

GnomAD4 exome AF: 0.0256 AC: 32099 AN: 1252808 Hom.: 529 Cov.: 33 AF XY: 0.0253 AC XY: 15509 AN XY: 611886

Gnomad4 AFR exome AF: 0.00332

Gnomad4 AMR exome AF: 0.0102

Gnomad4 ASJ exome AF: 0.0109

Gnomad4 EAS exome AF: 0.0000357

Gnomad4 SAS exome AF: 0.0150

Gnomad4 FIN exome AF: 0.0541

Gnomad4 NFE exome AF: 0.0274

Gnomad4 OTH exome AF: 0.0211

GnomAD4 genome AF: 0.0224 AC: 3404 AN: 152144 Hom.: 60 Cov.: 31 AF XY: 0.0239 AC XY: 1777 AN XY: 74388

Gnomad4 AFR AF: 0.00529

Gnomad4 AMR AF: 0.0233

Gnomad4 ASJ AF: 0.00951

Gnomad4 EAS AF: 0.000195

Gnomad4 SAS AF: 0.0154

Gnomad4 FIN AF: 0.0575

Gnomad4 NFE AF: 0.0286

Gnomad4 OTH AF: 0.0223

Alfa AF: 0.0185 Hom.: 3

ClinVar

Significance: Benign

Submissions summary: Benign:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Benign:2

Dec 19, 2020

GeneDx

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Feb 03, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

DNAH9-related disorder Benign:1

Nov 24, 2020

PreventionGenetics, part of Exact Sciences

Significance: Likely benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs761517350; hg19: chr17-11501856;