rs761517350

Variant names:

• chr17-11598539-A-ACGCGGATGGGGAACCCGGCGCCGAC
• rs761517350
• NM_001372.4:c.44_68dupCGGATGGGGAACCCGGCGCCGACCG

Your query was ambiguous. Multiple possible variants found:

• chr17-11598539-A-ACGCGGATGGGGAACCCGGCGCCGAC
• chr17-11598539-A-ACGCGGATGGGGAACCCGGCGCCGACCGCGGATGGGGAACCCGGCGCCGAC

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 8P and 16B. PVS1 BP6_Very_Strong BS1 BS2

The NM_001372.4(DNAH9):​c.44_68dupCGGATGGGGAACCCGGCGCCGACCG​(p.Arg24GlyfsTer36) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0253 in 1,404,952 control chromosomes in the GnomAD database, including 589 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★★). Synonymous variant affecting the same amino acid position (i.e. R23R) has been classified as Benign.

• Frequency:
  • Genomes: 𝑓 0.022 (60 hom., cov: 31)
  • Exomes 𝑓: 0.026 (529 hom.)
• Consequence: DNAH9 NM_001372.4 frameshift
• Clinical Significance: Benign criteria provided, multiple submitters, no conflicts B:3
• Conservation: PhyloP100: -0.735
• Publications: 2 publications found

Genes affected

DNAH9 (HGNC:2953): (dynein axonemal heavy chain 9) This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]

DNAH9 Gene-Disease associations (from GenCC):

• ciliary dyskinesia, primary, 40

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen, G2P
• primary ciliary dyskinesia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• situs inversus

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• schizophrenia

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 99 pathogenic variants in the truncated region.
• BP6: Variant 17-11598539-A-ACGCGGATGGGGAACCCGGCGCCGAC is Benign according to our data. Variant chr17-11598539-A-ACGCGGATGGGGAACCCGGCGCCGAC is described in ClinVar as Benign. ClinVar VariationId is 774512.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population nfe. GnomAd4 allele frequency = 0.0224 (3404/152144) while in subpopulation NFE AF = 0.0286 (1947/67968). AF 95% confidence interval is 0.0276. There are 60 homozygotes in GnomAd4. There are 1777 alleles in the male GnomAd4 subpopulation. Median coverage is 31. This position passed quality control check.
• BS2: High Homozygotes in GnomAd4 at 60 AR,AD gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001372.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DNAH9	NM_001372.4	MANE Select	c.44_68dupCGGATGGGGAACCCGGCGCCGACCG	p.Arg24GlyfsTer36	frameshift	Exon 1 of 69	NP_001363.2	Q9NYC9-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DNAH9	ENST00000262442.9	TSL:1 MANE Select	c.44_68dupCGGATGGGGAACCCGGCGCCGACCG	p.Arg24GlyfsTer36	frameshift	Exon 1 of 69	ENSP00000262442.3	Q9NYC9-1
	DNAH9	ENST00000579406.1	TSL:1	n.71_95dupCGGATGGGGAACCCGGCGCCGACCG		non_coding_transcript_exon	Exon 1 of 8
	DNAH9	ENST00000454412.6	TSL:5	c.44_68dupCGGATGGGGAACCCGGCGCCGACCG	p.Arg24GlyfsTer36	frameshift	Exon 1 of 68	ENSP00000414874.2	E7EP17

Frequencies

GnomAD3 genomes AF: 0.0224 AC: 3406 AN: 152032 Hom.: 60 Cov.: 31

Gnomad AFR AF: 0.00531

Gnomad AMI AF: 0.123

Gnomad AMR AF: 0.0234

Gnomad ASJ AF: 0.00951

Gnomad EAS AF: 0.000194

Gnomad SAS AF: 0.0158

Gnomad FIN AF: 0.0575

Gnomad MID AF: 0.0159

Gnomad NFE AF: 0.0286

Gnomad OTH AF: 0.0225

GnomAD2 exomes AF: 0.00162 AC: 48 AN: 29620 AF XY: 0.00185

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.000669

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00400

Gnomad NFE exome AF: 0.00233

Gnomad OTH exome AF: 0.00243

GnomAD4 exome AF: 0.0256 AC: 32099 AN: 1252808 Hom.: 529 Cov.: 33 AF XY: 0.0253 AC XY: 15509 AN XY: 611886

African (AFR) AF: 0.00332 AC: 83 AN: 25000

American (AMR) AF: 0.0102 AC: 162 AN: 15952

Ashkenazi Jewish (ASJ) AF: 0.0109 AC: 210 AN: 19198

East Asian (EAS) AF: 0.0000357 AC: 1 AN: 28016

South Asian (SAS) AF: 0.0150 AC: 898 AN: 60060

European-Finnish (FIN) AF: 0.0541 AC: 1638 AN: 30296

Middle Eastern (MID) AF: 0.0169 AC: 65 AN: 3856

European-Non Finnish (NFE) AF: 0.0274 AC: 27955 AN: 1018798

Other (OTH) AF: 0.0211 AC: 1087 AN: 51632

GnomAD4 genome AF: 0.0224 AC: 3404 AN: 152144 Hom.: 60 Cov.: 31 AF XY: 0.0239 AC XY: 1777 AN XY: 74388

African (AFR) AF: 0.00529 AC: 220 AN: 41562

American (AMR) AF: 0.0233 AC: 357 AN: 15296

Ashkenazi Jewish (ASJ) AF: 0.00951 AC: 33 AN: 3470

East Asian (EAS) AF: 0.000195 AC: 1 AN: 5140

South Asian (SAS) AF: 0.0154 AC: 74 AN: 4820

European-Finnish (FIN) AF: 0.0575 AC: 608 AN: 10574

Middle Eastern (MID) AF: 0.0171 AC: 5 AN: 292

European-Non Finnish (NFE) AF: 0.0286 AC: 1947 AN: 67968

Other (OTH) AF: 0.0223 AC: 47 AN: 2110

Alfa AF: 0.0185 Hom.: 3

ClinVar

ClinVar submissions

Significance: Benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	2	not provided (2)
-	-	1	DNAH9-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.73
Mutation Taster		=169/31	disease causing (fs/PTC)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs761517350; hg19: chr17-11501856; COSMIC: COSV52372599;