17-17136247-CCAGCAGCAGCAGCAGCAGCAG-C

Variant names:

• chr17-17136247-CCAGCAGCAGCAGCAGCAGCAG-C
• rs3833098
• NM_001364716.4:c.548_568delGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_001364716.4(MPRIP):​c.548_568delGCAGCAGCAGCAGCAGCAGCA​(p.Ser183_Ser189del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000964 in 1,555,914 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000010 (0 hom.)
• Consequence: MPRIP NM_001364716.4 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 2.67
• Publications: 15 publications found

Genes affected

MPRIP (HGNC:30321): (myosin phosphatase Rho interacting protein) Enables cadherin binding activity. Predicted to be involved in actin filament organization. Located in actin cytoskeleton and cytosol. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001364716.4

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MPRIP	NM_001364716.4	c.548_568delGCAGCAGCAGCAGCAGCAGCA	p.Ser183_Ser189del	disruptive_inframe_deletion	Exon 6 of 24	ENST00000651222.2	NP_001351645.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MPRIP	ENST00000651222.2	c.548_568delGCAGCAGCAGCAGCAGCAGCA	p.Ser183_Ser189del	disruptive_inframe_deletion	Exon 6 of 24		NM_001364716.4	ENSP00000498253.1

Frequencies

GnomAD3 genomes AF: 0.00000664 AC: 1 AN: 150558 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.000484

GnomAD4 exome AF: 0.00000996 AC: 14 AN: 1405356 Hom.: 0 AF XY: 0.0000157 AC XY: 11 AN XY: 699204

African (AFR) AF: 0.00 AC: 0 AN: 32276

American (AMR) AF: 0.00 AC: 0 AN: 42486

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25202

East Asian (EAS) AF: 0.000134 AC: 5 AN: 37396

South Asian (SAS) AF: 0.000109 AC: 9 AN: 82924

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 49608

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5640

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1071920

Other (OTH) AF: 0.00 AC: 0 AN: 57904

GnomAD4 genome AF: 0.00000664 AC: 1 AN: 150558 Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0 AN XY: 73426

African (AFR) AF: 0.00 AC: 0 AN: 40848

American (AMR) AF: 0.00 AC: 0 AN: 15104

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3464

East Asian (EAS) AF: 0.00 AC: 0 AN: 5090

South Asian (SAS) AF: 0.00 AC: 0 AN: 4730

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10400

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 314

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 67634

Other (OTH) AF: 0.000484 AC: 1 AN: 2066

Alfa AF: 0.00 Hom.: 3215

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.7
Mutation Taster		=166/34	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3833098; hg19: chr17-17039561;