17-17136247-CCAGCAGCAGCAGCAGCAGCAG-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant names:

• chr17-17136247-C-CCAGCAGCAGCAGCAGCAGCAG
• rs3833098
• NM_001364716.4:c.548_568dupGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_001364716.4(MPRIP):​c.548_568dupGCAGCAGCAGCAGCAGCAGCA​(p.Ser183_Ser189dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 0)
  • Exomes 𝑓: 0.0000014 (0 hom.)
• Consequence: MPRIP NM_001364716.4 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -0.511
• Publications: 0 publications found

Genes affected

MPRIP (HGNC:30321): (myosin phosphatase Rho interacting protein) Enables cadherin binding activity. Predicted to be involved in actin filament organization. Located in actin cytoskeleton and cytosol. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001364716.4

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001364716.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MPRIP	NM_001364716.4	MANE Select	c.548_568dupGCAGCAGCAGCAGCAGCAGCA	p.Ser183_Ser189dup	disruptive_inframe_insertion	Exon 6 of 24	NP_001351645.2	A0A494BZV2
	MPRIP	NM_015134.4		c.548_568dupGCAGCAGCAGCAGCAGCAGCA	p.Ser183_Ser189dup	disruptive_inframe_insertion	Exon 6 of 23	NP_055949.2	Q6WCQ1-2
	MPRIP	NM_201274.4		c.548_568dupGCAGCAGCAGCAGCAGCAGCA	p.Ser183_Ser189dup	disruptive_inframe_insertion	Exon 6 of 24	NP_958431.2	Q6WCQ1-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MPRIP	ENST00000651222.2	MANE Select	c.548_568dupGCAGCAGCAGCAGCAGCAGCA	p.Ser183_Ser189dup	disruptive_inframe_insertion	Exon 6 of 24	ENSP00000498253.1	A0A494BZV2
	MPRIP	ENST00000395811.9	TSL:1	c.548_568dupGCAGCAGCAGCAGCAGCAGCA	p.Ser183_Ser189dup	disruptive_inframe_insertion	Exon 6 of 23	ENSP00000379156.4	Q6WCQ1-2
	MPRIP	ENST00000584067.5	TSL:1	c.80_100dupGCAGCAGCAGCAGCAGCAGCA	p.Ser27_Ser33dup	disruptive_inframe_insertion	Exon 2 of 18	ENSP00000462688.1	J3KSW8

Frequencies

GnomAD3 genomes Cov.: 0

GnomAD4 exome AF: 0.00000142 AC: 2 AN: 1405356 Hom.: 0 Cov.: 0 AF XY: 0.00000143 AC XY: 1 AN XY: 699204

African (AFR) AF: 0.00 AC: 0 AN: 32276

American (AMR) AF: 0.00 AC: 0 AN: 42486

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25202

East Asian (EAS) AF: 0.00 AC: 0 AN: 37396

South Asian (SAS) AF: 0.00 AC: 0 AN: 82924

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 49608

Middle Eastern (MID) AF: 0.000177 AC: 1 AN: 5640

European-Non Finnish (NFE) AF: 9.33e-7 AC: 1 AN: 1071920

Other (OTH) AF: 0.00 AC: 0 AN: 57904

GnomAD4 genome Cov.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.51

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3833098; hg19: chr17-17039561;