17-17136247-CCAGCAGCAGCAGCAGCAGCAG-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant names:

• chr17-17136247-C-CCAGCAGCAGCAGCAGCAGCAG
• NM_001364716.4:c.548_568dupGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. Variant got -1 ACMG points: 0P and 1B. BP3

The NM_001364716.4(MPRIP):​c.548_568dupGCAGCAGCAGCAGCAGCAGCA​(p.Ser183_Ser189dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 0)
  • Exomes 𝑓: 0.0000014 (0 hom.)
• Consequence: MPRIP NM_001364716.4 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -0.511

Genes affected

MPRIP (HGNC:30321): (myosin phosphatase Rho interacting protein) Enables cadherin binding activity. Predicted to be involved in actin filament organization. Located in actin cytoskeleton and cytosol. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Likely_benign. Variant got -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001364716.4

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MPRIP	NM_001364716.4	c.548_568dupGCAGCAGCAGCAGCAGCAGCA	p.Ser183_Ser189dup	disruptive_inframe_insertion	Exon 6 of 24	ENST00000651222.2	NP_001351645.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MPRIP	ENST00000651222.2	c.548_568dupGCAGCAGCAGCAGCAGCAGCA	p.Ser183_Ser189dup	disruptive_inframe_insertion	Exon 6 of 24		NM_001364716.4	ENSP00000498253.1

Frequencies

GnomAD3 genomes Cov.: 0

GnomAD4 exome AF: 0.00000142 AC: 2 AN: 1405356 Hom.: 0 Cov.: 0 AF XY: 0.00000143 AC XY: 1 AN XY: 699204

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 9.33e-7

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr17-17039561;