17-32933275-TGGAGAATGAAGACTGGATCGAAGATGCCTCGTAA-T

Variant names:

• chr17-32933275-TGGAGAATGAAGACTGGATCGAAGATGCCTCGTAA-T
• rs869312734
• NM_015544.3:c.236_263+6delAGAATGAAGACTGGATCGAAGATGCCTCGTAAGG

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 1P and 0B. PP5

The NM_015544.3(TMEM98):​c.236_263+6delAGAATGAAGACTGGATCGAAGATGCCTCGTAAGG​(p.Glu79SerfsTer9) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: TMEM98 NM_015544.3 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.57
• Publications: 0 publications found

Genes affected

TMEM98 (HGNC:24529): (transmembrane protein 98) This gene encodes a transmembrane protein. A missense mutation in this gene result in Nanophthalmos 4 (NNO4). Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2014]

TMEM98 Gene-Disease associations (from GenCC):

• nanophthalmos 4

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Ambry Genetics, PanelApp Australia, Labcorp Genetics (formerly Invitae), G2P
• nanophthalmia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

• PP5: Variant 17-32933275-TGGAGAATGAAGACTGGATCGAAGATGCCTCGTAA-T is Pathogenic according to our data. Variant chr17-32933275-TGGAGAATGAAGACTGGATCGAAGATGCCTCGTAA-T is described in ClinVar as Pathogenic. ClinVar VariationId is 224332.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TMEM98	NM_015544.3	c.236_263+6delAGAATGAAGACTGGATCGAAGATGCCTCGTAAGG	p.Glu79SerfsTer9	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 4 of 8	ENST00000579849.6	NP_056359.2
TMEM98	NM_001033504.2	c.236_263+6delAGAATGAAGACTGGATCGAAGATGCCTCGTAAGG	p.Glu79SerfsTer9	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 3 of 7		NP_001028676.1
TMEM98	NM_001301746.2	c.236_263+6delAGAATGAAGACTGGATCGAAGATGCCTCGTAAGG	p.Glu79SerfsTer9	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 5 of 9		NP_001288675.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TMEM98	ENST00000579849.6	c.234_263+4delGGAGAATGAAGACTGGATCGAAGATGCCTCGTAA	p.Glu79_Ser88del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 4 of 8	1	NM_015544.3	ENSP00000463245.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Nanophthalmos 4 Pathogenic:1

Mar 10, 2016

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.6
Mutation Taster		=4/196	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs869312734; hg19: chr17-31260293;