17-32933275-TGGAGAATGAAGACTGGATCGAAGATGCCTCGTAA-T

Position:

• chr17-32933275-TGGAGAATGAAGACTGGATCGAAGATGCCTCGTAA-T

Variant summary

Our verdict is Uncertain significance. Variant got 3 ACMG points: 3P and 0B. PM2 PP5

The NM_015544.3(TMEM98):​c.236_263+6delAGAATGAAGACTGGATCGAAGATGCCTCGTAAGG​(p.Glu79fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: TMEM98 NM_015544.3 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.57

Genes affected

TMEM98 (HGNC:24529): (transmembrane protein 98) This gene encodes a transmembrane protein. A missense mutation in this gene result in Nanophthalmos 4 (NNO4). Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2014]

TMEM98 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 3 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 17-32933275-TGGAGAATGAAGACTGGATCGAAGATGCCTCGTAA-T is Pathogenic according to our data. Variant chr17-32933275-TGGAGAATGAAGACTGGATCGAAGATGCCTCGTAA-T is described in ClinVar as [Pathogenic]. Clinvar id is 224332.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
TMEM98	NM_015544.3	c.236_263+6delAGAATGAAGACTGGATCGAAGATGCCTCGTAAGG	p.Glu79fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	4/8	ENST00000579849.6	NP_056359.2
TMEM98	NM_001033504.2	c.236_263+6delAGAATGAAGACTGGATCGAAGATGCCTCGTAAGG	p.Glu79fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	3/7		NP_001028676.1
TMEM98	NM_001301746.2	c.236_263+6delAGAATGAAGACTGGATCGAAGATGCCTCGTAAGG	p.Glu79fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	5/9		NP_001288675.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
TMEM98	ENST00000579849.6	c.236_263+6delAGAATGAAGACTGGATCGAAGATGCCTCGTAAGG	p.Glu79fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	4/8	1	NM_015544.3	ENSP00000463245.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Nanophthalmos 4 Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

Mar 10, 2016

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs869312734; hg19: chr17-31260293;