rs869312734

Variant names:

• chr17-32933275-TGGAGAATGAAGACTGGATCGAAGATGCCTCGTAA-T
• rs869312734
• NM_015544.3:c.236_263+6delAGAATGAAGACTGGATCGAAGATGCCTCGTAAGG

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PVS1_Strong PP5

The ENST00000579849.6(TMEM98):​c.234_263+4delGGAGAATGAAGACTGGATCGAAGATGCCTCGTAA​(p.Glu79_Ser88del) variant causes a splice donor, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: TMEM98 ENST00000579849.6 splice_donor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.57
• Publications: 0 publications found

Genes affected

TMEM98 (HGNC:24529): (transmembrane protein 98) This gene encodes a transmembrane protein. A missense mutation in this gene result in Nanophthalmos 4 (NNO4). Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2014]

TMEM98 Gene-Disease associations (from GenCC):

• nanophthalmos 4

  Inheritance: AD Classification: STRONG, MODERATE, LIMITED Submitted by: Ambry Genetics, PanelApp Australia, G2P, Labcorp Genetics (formerly Invitae), ClinGen
• nanophthalmia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.1938326 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
• PP5: Variant 17-32933275-TGGAGAATGAAGACTGGATCGAAGATGCCTCGTAA-T is Pathogenic according to our data. Variant chr17-32933275-TGGAGAATGAAGACTGGATCGAAGATGCCTCGTAA-T is described in ClinVar as Pathogenic. ClinVar VariationId is 224332.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000579849.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TMEM98	NM_015544.3	MANE Select	c.236_263+6delAGAATGAAGACTGGATCGAAGATGCCTCGTAAGG	p.Glu79SerfsTer9	frameshift splice_donor splice_region intron	Exon 4 of 8	NP_056359.2	Q9Y2Y6
	TMEM98	NM_001033504.2		c.236_263+6delAGAATGAAGACTGGATCGAAGATGCCTCGTAAGG	p.Glu79SerfsTer9	frameshift splice_donor splice_region intron	Exon 3 of 7	NP_001028676.1	Q9Y2Y6
	TMEM98	NM_001301746.2		c.236_263+6delAGAATGAAGACTGGATCGAAGATGCCTCGTAAGG	p.Glu79SerfsTer9	frameshift splice_donor splice_region intron	Exon 5 of 9	NP_001288675.1	Q9Y2Y6

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TMEM98	ENST00000579849.6	TSL:1 MANE Select	c.234_263+4delGGAGAATGAAGACTGGATCGAAGATGCCTCGTAA	p.Glu79_Ser88del	splice_donor conservative_inframe_deletion splice_region intron	Exon 4 of 8	ENSP00000463245.1	Q9Y2Y6
	TMEM98	ENST00000394642.7	TSL:2	c.234_263+4delGGAGAATGAAGACTGGATCGAAGATGCCTCGTAA	p.Glu79_Ser88del	splice_donor conservative_inframe_deletion splice_region intron	Exon 3 of 7	ENSP00000378138.3	Q9Y2Y6
	TMEM98	ENST00000851236.1		c.234_263+4delGGAGAATGAAGACTGGATCGAAGATGCCTCGTAA	p.Glu79_Ser88del	splice_donor conservative_inframe_deletion splice_region intron	Exon 4 of 8	ENSP00000521295.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Nanophthalmos 4 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.6
Mutation Taster		=4/196	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs869312734; hg19: chr17-31260293;