17-3658081-TCGTGGCTGCAGTGGGAGTGACCA-T

Variant names:

• chr17-3658081-TCGTGGCTGCAGTGGGAGTGACCA-T
• rs759623796
• NM_004937.3:c.771_793delGGGAGTGACCACGTGGCTGCAGT

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_004937.3(CTNS):​c.771_793delGGGAGTGACCACGTGGCTGCAGT​(p.Gly258SerfsTer30) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.0000093 in 1,612,260 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: 𝑓 0.000013 (0 hom., cov: 33)
  • Exomes 𝑓: 0.0000089 (0 hom.)
• Consequence: CTNS NM_004937.3 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:11
• Conservation: PhyloP100: 7.44
• Publications: 5 publications found

Genes affected

CTNS (HGNC:2518): (cystinosin, lysosomal cystine transporter) This gene encodes a seven-transmembrane domain protein that functions to transport cystine out of lysosomes. Its activity is driven by the H+ electrochemical gradient of the lysosomal membrane. Mutations in this gene cause cystinosis, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]

CTNS-AS1 (HGNC:56090): (CTNS antisense RNA 1)

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 17-3658081-TCGTGGCTGCAGTGGGAGTGACCA-T is Pathogenic according to our data. Variant chr17-3658081-TCGTGGCTGCAGTGGGAGTGACCA-T is described in ClinVar as Pathogenic. ClinVar VariationId is 496276.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004937.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CTNS	NM_004937.3	MANE Select	c.771_793delGGGAGTGACCACGTGGCTGCAGT	p.Gly258SerfsTer30	frameshift	Exon 10 of 12	NP_004928.2	O60931-1
	CTNS	NM_001031681.3		c.771_793delGGGAGTGACCACGTGGCTGCAGT	p.Gly258SerfsTer30	frameshift	Exon 10 of 13	NP_001026851.2	O60931-2
	CTNS	NM_001374492.1		c.771_793delGGGAGTGACCACGTGGCTGCAGT	p.Gly258SerfsTer30	frameshift	Exon 10 of 13	NP_001361421.1	O60931-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CTNS	ENST00000046640.9	TSL:1 MANE Select	c.771_793delGGGAGTGACCACGTGGCTGCAGT	p.Gly258SerfsTer30	frameshift	Exon 10 of 12	ENSP00000046640.4	O60931-1
	CTNS	ENST00000381870.8	TSL:1	c.771_793delGGGAGTGACCACGTGGCTGCAGT	p.Gly258SerfsTer30	frameshift	Exon 10 of 13	ENSP00000371294.3	O60931-2
	CTNS	ENST00000673965.1		c.771_793delGGGAGTGACCACGTGGCTGCAGT	p.Gly258SerfsTer30	frameshift	Exon 10 of 12	ENSP00000500995.1	O60931-1

Frequencies

GnomAD3 genomes AF: 0.0000132 AC: 2 AN: 152072 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.0000241

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000207

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000279 AC: 7 AN: 251296 AF XY: 0.0000294

Gnomad AFR exome AF: 0.0000616

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000880

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000890 AC: 13 AN: 1460070 Hom.: 0 AF XY: 0.0000110 AC XY: 8 AN XY: 726384

African (AFR) AF: 0.00 AC: 0 AN: 33424

American (AMR) AF: 0.00 AC: 0 AN: 44722

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26132

East Asian (EAS) AF: 0.00 AC: 0 AN: 39694

South Asian (SAS) AF: 0.000116 AC: 10 AN: 86188

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53234

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4486

European-Non Finnish (NFE) AF: 0.00000180 AC: 2 AN: 1111946

Other (OTH) AF: 0.0000166 AC: 1 AN: 60244

GnomAD4 genome AF: 0.0000131 AC: 2 AN: 152190 Hom.: 0 Cov.: 33 AF XY: 0.0000134 AC XY: 1 AN XY: 74420

African (AFR) AF: 0.0000241 AC: 1 AN: 41566

American (AMR) AF: 0.00 AC: 0 AN: 15306

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5188

South Asian (SAS) AF: 0.000207 AC: 1 AN: 4830

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10628

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 67880

Other (OTH) AF: 0.00 AC: 0 AN: 2116

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.0000151

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
6	-	-	Nephropathic cystinosis (6)
2	-	-	Cystinosis (2)
1	-	-	Juvenile nephropathic cystinosis;C0950123:Inborn genetic diseases;C2931013:Ocular cystinosis (1)
1	-	-	Juvenile nephropathic cystinosis;C2931013:Ocular cystinosis;C2931187:Nephropathic cystinosis (1)
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.4
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs759623796; hg19: chr17-3561375;