17-43057092-T-TGGTTTCTTCCATTGACCACATCTCCTCTGACTTCAAAATCATGCTGAAAGAAA

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate

The NM_007294.4(BRCA1):​c.5194-10_5236dupTTTCTTTCAGCATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGAAACC​(p.His1746LeufsTer37) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. H1746H) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 31)

Consequence

BRCA1
NM_007294.4 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 5.96

Publications

0 publications found
Variant links:
Genes affected
BRCA1 (HGNC:1100): (BRCA1 DNA repair associated) This gene encodes a 190 kD nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The BRCA1 gene contains 22 exons spanning about 110 kb of DNA. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2020]
BRCA1 Gene-Disease associations (from GenCC):
  • breast-ovarian cancer, familial, susceptibility to, 1
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
  • Fanconi anemia, complementation group S
    Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE, LIMITED Submitted by: G2P, Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics
  • pancreatic cancer, susceptibility to, 4
    Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
  • hereditary breast ovarian cancer syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • Fanconi anemia
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 10 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 17-43057092-T-TGGTTTCTTCCATTGACCACATCTCCTCTGACTTCAAAATCATGCTGAAAGAAA is Pathogenic according to our data. Variant chr17-43057092-T-TGGTTTCTTCCATTGACCACATCTCCTCTGACTTCAAAATCATGCTGAAAGAAA is described in ClinVar as [Pathogenic]. Clinvar id is 495094.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
BRCA1NM_007294.4 linkc.5194-10_5236dupTTTCTTTCAGCATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGAAACC p.His1746LeufsTer37 frameshift_variant Exon 19 of 23 ENST00000357654.9 NP_009225.1 P38398-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
BRCA1ENST00000357654.9 linkc.5236_5237insTTTCTTTCAGCATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGAAACC p.His1746LeufsTer37 frameshift_variant Exon 19 of 23 1 NM_007294.4 ENSP00000350283.3 P38398-1

Frequencies

GnomAD3 genomes
Cov.:
31
GnomAD4 exome
Cov.:
31
GnomAD4 genome
Cov.:
31

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Hereditary cancer-predisposing syndrome Pathogenic:1
Jan 01, 2020
GeneKor MSA
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This variant causing a frameshift after codon 1746 and this creates a premature translational stop signal 37 amino acid residues later. This is expected to result in an absent or disrupted protein product. Truncating variants in BRCA1 are known to be pathogenic (PMID: 20104584). This variant has been described in the international literature in an individual undergoing panel testing for hereditary syndrome (PMID: 31159747). -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
6.0
Mutation Taster
=0/200
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555576921; hg19: chr17-41209109; API