rs1555576921

Variant names:

• chr17-43057092-T-TGGTTTCTTCCATTGACCACATCTCCTCTGACTTCAAAATCATGCTGAAAGAAA
• rs1555576921
• NM_007294.4:c.5194-10_5236dupTTTCTTTCAGCATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGAAACC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_007294.4(BRCA1):​c.5194-10_5236dupTTTCTTTCAGCATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGAAACC​(p.His1746LeufsTer37) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. H1746H) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 31)
• Consequence: BRCA1 NM_007294.4 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 5.96
• Publications: 0 publications found

Genes affected

BRCA1 (HGNC:1100): (BRCA1 DNA repair associated) This gene encodes a 190 kD nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The BRCA1 gene contains 22 exons spanning about 110 kb of DNA. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2020]

BRCA1 Gene-Disease associations (from GenCC):

• breast-ovarian cancer, familial, susceptibility to, 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
• Fanconi anemia, complementation group S

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE, LIMITED Submitted by: G2P, Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics
• pancreatic cancer, susceptibility to, 4

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• hereditary breast ovarian cancer syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Fanconi anemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 17-43057092-T-TGGTTTCTTCCATTGACCACATCTCCTCTGACTTCAAAATCATGCTGAAAGAAA is Pathogenic according to our data. Variant chr17-43057092-T-TGGTTTCTTCCATTGACCACATCTCCTCTGACTTCAAAATCATGCTGAAAGAAA is described in ClinVar as [Pathogenic]. Clinvar id is 495094.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
BRCA1	NM_007294.4	c.5194-10_5236dupTTTCTTTCAGCATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGAAACC	p.His1746LeufsTer37	frameshift_variant	Exon 19 of 23	ENST00000357654.9	NP_009225.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
BRCA1	ENST00000357654.9	c.5236_5237insTTTCTTTCAGCATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGAAACC	p.His1746LeufsTer37	frameshift_variant	Exon 19 of 23	1	NM_007294.4	ENSP00000350283.3

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 31

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hereditary cancer-predisposing syndrome Pathogenic:1

Jan 01, 2020

GeneKor MSA

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant causing a frameshift after codon 1746 and this creates a premature translational stop signal 37 amino acid residues later. This is expected to result in an absent or disrupted protein product. Truncating variants in BRCA1 are known to be pathogenic (PMID: 20104584). This variant has been described in the international literature in an individual undergoing panel testing for hereditary syndrome (PMID: 31159747). -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.0
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555576921; hg19: chr17-41209109;