17-56844115-TCCACCAAGTTATTTAACATCCA-T

Variant names:

• chr17-56844115-TCCACCAAGTTATTTAACATCCA-T
• NM_003647.3:c.562_583delCCACCAAGTTATTTAACATCCA

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_003647.3(DGKE):​c.562_583delCCACCAAGTTATTTAACATCCA​(p.Pro188LeufsTer15) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: DGKE NM_003647.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 7.20

Genes affected

DGKE (HGNC:2852): (diacylglycerol kinase epsilon) Diacylglycerol kinases are thought to be involved mainly in the regeneration of phosphatidylinositol (PI) from diacylglycerol in the PI-cycle during cell signal transduction. When expressed in mammalian cells, DGK-epsilon shows specificity for arachidonyl-containing diacylglycerol. DGK-epsilon is expressed predominantly in testis. [provided by RefSeq, Jul 2008]

TRIM25 (HGNC:12932): (tripartite motif containing 25) The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein is an RNA binding protein, functions as a ubiquitin E3 ligase and is involved in multiple cellular processes, including regulation of antiviral innate immunity. [provided by RefSeq, Sep 2021]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 17-56844115-TCCACCAAGTTATTTAACATCCA-T is Pathogenic according to our data. Variant chr17-56844115-TCCACCAAGTTATTTAACATCCA-T is described in ClinVar as [Pathogenic]. Clinvar id is 1986461.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
DGKE	NM_003647.3	c.562_583delCCACCAAGTTATTTAACATCCA	p.Pro188LeufsTer15	frameshift_variant	Exon 3 of 12	ENST00000284061.8	NP_003638.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
DGKE	ENST00000284061.8	c.562_583delCCACCAAGTTATTTAACATCCA	p.Pro188LeufsTer15	frameshift_variant	Exon 3 of 12	1	NM_003647.3	ENSP00000284061.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Apr 23, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Pro188Leufs*15) in the DGKE gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in DGKE are known to be pathogenic (PMID: 23274426, 23542698). For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with DGKE-related conditions. This variant is not present in population databases (gnomAD no frequency). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr17-54921476;