17-58703294-T-TATCTTCTTCCAGATTTCCTTTCAGAACACTCAAAGGTATGAGTCAGACTACTGAAATGTAACTAACCAAGTATTTTTTGAGGTGTTTGATAAGCATGAA

Position:

• chr17-58703294-T-TATCTTCTTCCAGATTTCCTTTCAGAACACTCAAAGGTATGAGTCAGACTACTGAAATGTAACTAACCAAGTATTTTTTGAGGTGTTTGATAAGCATGAA

Variant summary

Our verdict is Likely pathogenic. Variant got 7 ACMG points: 8P and 1B. PVS1 BP6

The NM_058216.3(RAD51C):​c.672_705+65dup variant causes a stop gained, inframe insertion change involving the alteration of a conserved nucleotide. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: 𝑓 0.0 (0 hom., cov: 31)
  • Exomes 𝑓: 0.0000048 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: RAD51C NM_058216.3 stop_gained, inframe_insertion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:2 B:1 O:1
• Conservation: PhyloP100: 7.77

Genes affected

RAD51C (HGNC:9820): (RAD51 paralog C) This gene is a member of the RAD51 family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51 and are known to be involved in the homologous recombination and repair of DNA. This protein can interact with other RAD51 paralogs and is reported to be important for Holliday junction resolution. Mutations in this gene are associated with Fanconi anemia-like syndrome. This gene is one of four localized to a region of chromosome 17q23 where amplification occurs frequently in breast tumors. Overexpression of the four genes during amplification has been observed and suggests a possible role in tumor progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

ACMG classification

Verdict is Likely_pathogenic. Variant got 7 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• BP6: Variant 17-58703294-T-TATCTTCTTCCAGATTTCCTTTCAGAACACTCAAAGGTATGAGTCAGACTACTGAAATGTAACTAACCAAGTATTTTTTGAGGTGTTTGATAAGCATGAA is Benign according to our data. Variant chr17-58703294-T-TATCTTCTTCCAGATTTCCTTTCAGAACACTCAAAGGTATGAGTCAGACTACTGAAATGTAACTAACCAAGTATTTTTTGAGGTGTTTGATAAGCATGAA is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 232156.We mark this variant Likely_benign, oryginal submissions are: {Likely_benign=1, not_provided=1, Uncertain_significance=2}.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
RAD51C	NM_058216.3	c.672_705+65dup		stop_gained, inframe_insertion	4/9	ENST00000337432.9	NP_478123.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
RAD51C	ENST00000337432.9	c.672_705+65dup		stop_gained, inframe_insertion	4/9	1	NM_058216.3	ENSP00000336701	P2

Frequencies

GnomAD3 genomes AF: 0.00 AC: 0 AN: 152218 Hom.: 0 Cov.: 31 FAILED QC

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000480 AC: 7 AN: 1459194 Hom.: 0 Cov.: 31 AF XY: 0.00000275 AC XY: 2 AN XY: 726070

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.000157

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Data not reliable, filtered out with message: AC0;AS_VQSR AF: 0.00 AC: 0 AN: 152218 Hom.: 0 Cov.: 31 AF XY: 0.00 AC XY: 0 AN XY: 74374

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:2 Benign:1 Other:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Hereditary cancer-predisposing syndrome Uncertain:1 Benign:1

Uncertain significance, criteria provided, single submitter	clinical testing	Color Diagnostics, LLC DBA Color Health	Jan 27, 2022	This variant causes a duplication of the 3' end of exon 4 and the 5' end of intron 4 of the RAD51C gene. This variant creates a duplicate copy of the intron 4 splice donor site, however, the splicing impact if any has not been functionally tested. To our knowledge, functional studies have not been performed for this variant. This variant has not been reported in individuals affected with hereditary cancer in the literature. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. -
Likely benign, criteria provided, single submitter	clinical testing	Ambry Genetics	May 05, 2021	This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

Fanconi anemia complementation group O Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Aug 12, 2021

- -

Fanconi anemia complementation group O;C3150659:Breast-ovarian cancer, familial, susceptibility to, 3 Other:1

not provided, no classification provided

phenotyping only

GenomeConnect - Invitae Patient Insights Network

-

Variant interpreted as Uncertain significance and reported on 06-12-2017 by Invitae. GenomeConnect-Invitae Patient Insights Network assertions are reported exactly as they appear on the patient-provided report from the testing laboratory. Registry team members make no attempt to reinterpret the clinical significance of the variant. Phenotypic details are available under supporting information. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555597214; hg19: chr17-56780655;