17-63632695-T-TTGAACTCAATCATGAACGATCTGGTGGCCCTCCAGATGAACC

Variant names:

• chr17-63632695-T-TTGAACTCAATCATGAACGATCTGGTGGCCCTCCAGATGAACC
• NM_002401.5:c.20_61dupTGAACTCAATCATGAACGATCTGGTGGCCCTCCAGATGAACC

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_002401.5(MAP3K3):​c.20_61dupTGAACTCAATCATGAACGATCTGGTGGCCCTCCAGATGAACC​(p.Leu7_Asn20dup) variant causes a disruptive inframe insertion change. The variant was absent in control chromosomes in GnomAD project. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 32)
• Consequence: MAP3K3 NM_002401.5 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 5.46

Genes affected

MAP3K3 (HGNC:6855): (mitogen-activated protein kinase kinase kinase 3) This gene product is a 626-amino acid polypeptide that is 96.5% identical to mouse Mekk3. Its catalytic domain is closely related to those of several other kinases, including mouse Mekk2, tobacco NPK, and yeast Ste11. Northern blot analysis revealed a 4.6-kb transcript that appears to be ubiquitously expressed. This protein directly regulates the stress-activated protein kinase (SAPK) and extracellular signal-regulated protein kinase (ERK) pathways by activating SEK and MEK1/2 respectively; it does not regulate the p38 pathway. In cotransfection assays, it enhanced transcription from a nuclear factor kappa-B (NFKB)-dependent reporter gene, consistent with a role in the SAPK pathway. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_002401.5.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MAP3K3	NM_002401.5	c.20_61dupTGAACTCAATCATGAACGATCTGGTGGCCCTCCAGATGAACC	p.Leu7_Asn20dup	disruptive_inframe_insertion	Exon 2 of 16	ENST00000361733.8	NP_002392.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MAP3K3	ENST00000361733.8	c.20_61dupTGAACTCAATCATGAACGATCTGGTGGCCCTCCAGATGAACC	p.Leu7_Asn20dup	disruptive_inframe_insertion	Exon 2 of 16	1	NM_002401.5	ENSP00000354485.4

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Jun 03, 2024

Clinical Genomics Laboratory, Washington University in St. Louis

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

A MAP3K3 c.20_61dup (p.Leu7_Asn20dup) variant was identified at an allelic fraction consistent with somatic origin. This variant, to our knowledge, has not been reported in the medical literature and is absent from the general population (gnomAD v4.1.0), indicating it is not a common variant. This variant is predicted to cause a change in the length of the protein due to an in-frame duplication of 14 amino acids in a non-repeat region.Due to limited information, and based on internally developed protocol informed by the ACMG/AMP guidelines for variant interpretation (Leon-Quintero FZ et al., PMID: 39434542), the clinical significance of this variant is uncertain at this time. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr17-61710055;