NM_002401.5:c.20_61dupTGAACTCAATCATGAACGATCTGGTGGCCCTCCAGATGAACC

Variant names:

• chr17-63632695-T-TTGAACTCAATCATGAACGATCTGGTGGCCCTCCAGATGAACC
• NM_002401.5:c.20_61dupTGAACTCAATCATGAACGATCTGGTGGCCCTCCAGATGAACC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_002401.5(MAP3K3):​c.20_61dupTGAACTCAATCATGAACGATCTGGTGGCCCTCCAGATGAACC​(p.Leu7_Asn20dup) variant causes a disruptive inframe insertion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: MAP3K3 NM_002401.5 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 5.46
• Publications: 0 publications found

Genes affected

MAP3K3 (HGNC:6855): (mitogen-activated protein kinase kinase kinase 3) This gene product is a 626-amino acid polypeptide that is 96.5% identical to mouse Mekk3. Its catalytic domain is closely related to those of several other kinases, including mouse Mekk2, tobacco NPK, and yeast Ste11. Northern blot analysis revealed a 4.6-kb transcript that appears to be ubiquitously expressed. This protein directly regulates the stress-activated protein kinase (SAPK) and extracellular signal-regulated protein kinase (ERK) pathways by activating SEK and MEK1/2 respectively; it does not regulate the p38 pathway. In cotransfection assays, it enhanced transcription from a nuclear factor kappa-B (NFKB)-dependent reporter gene, consistent with a role in the SAPK pathway. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_002401.5.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_002401.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MAP3K3	NM_002401.5	MANE Select	c.20_61dupTGAACTCAATCATGAACGATCTGGTGGCCCTCCAGATGAACC	p.Leu7_Asn20dup	disruptive_inframe_insertion	Exon 2 of 16	NP_002392.2
	MAP3K3	NM_203351.3		c.20_61dupTGAACTCAATCATGAACGATCTGGTGGCCCTCCAGATGAACC	p.Leu7_Asn20dup	disruptive_inframe_insertion	Exon 2 of 17	NP_976226.1	Q99759-2
	MAP3K3	NM_001363768.2		c.20_61dupTGAACTCAATCATGAACGATCTGGTGGCCCTCCAGATGAACC	p.Leu7_Asn20dup	disruptive_inframe_insertion	Exon 2 of 17	NP_001350697.1	J3QRB6

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MAP3K3	ENST00000361733.8	TSL:1 MANE Select	c.20_61dupTGAACTCAATCATGAACGATCTGGTGGCCCTCCAGATGAACC	p.Leu7_Asn20dup	disruptive_inframe_insertion	Exon 2 of 16	ENSP00000354485.4	Q99759-1
	MAP3K3	ENST00000361357.7	TSL:1	c.20_61dupTGAACTCAATCATGAACGATCTGGTGGCCCTCCAGATGAACC	p.Leu7_Asn20dup	disruptive_inframe_insertion	Exon 2 of 17	ENSP00000354927.3	Q99759-2
	MAP3K3	ENST00000579585.5	TSL:1	c.20_61dupTGAACTCAATCATGAACGATCTGGTGGCCCTCCAGATGAACC	p.Leu7_Asn20dup	disruptive_inframe_insertion	Exon 3 of 18	ENSP00000461988.1	Q99759-2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.5

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr17-61710055;