17-7676105-GGCTGGTGCAGGGGCCGCCGGTGTAGGAGCT-G

Position:

• chr17-7676105-GGCTGGTGCAGGGGCCGCCGGTGTAGGAGCT-G

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The ENST00000269305.9(TP53):​c.234_263del​(p.Ala79_Ala88del) variant causes a inframe deletion change. The variant allele was found at a frequency of 0.00000274 in 1,460,716 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. A78A) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.0 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000027 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: TP53 ENST00000269305.9 inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:9
• Conservation: PhyloP100: 4.75

Genes affected

TP53 (HGNC:11998): (tumor protein p53) This gene encodes a tumor suppressor protein containing transcriptional activation, DNA binding, and oligomerization domains. The encoded protein responds to diverse cellular stresses to regulate expression of target genes, thereby inducing cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. Mutations in this gene are associated with a variety of human cancers, including hereditary cancers such as Li-Fraumeni syndrome. Alternative splicing of this gene and the use of alternate promoters result in multiple transcript variants and isoforms. Additional isoforms have also been shown to result from the use of alternate translation initiation codons from identical transcript variants (PMIDs: 12032546, 20937277). [provided by RefSeq, Dec 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in ENST00000269305.9.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
TP53	NM_000546.6	c.234_263del	p.Ala79_Ala88del	inframe_deletion	4/11	ENST00000269305.9	NP_000537.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
TP53	ENST00000269305.9	c.234_263del	p.Ala79_Ala88del	inframe_deletion	4/11	1	NM_000546.6	ENSP00000269305	P1

Frequencies

GnomAD3 genomes AF: 0.00 AC: 0 AN: 152144 Hom.: 0 Cov.: 32 FAILED QC

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.0000240 AC: 6 AN: 250382 Hom.: 0 AF XY: 0.0000221 AC XY: 3 AN XY: 135704

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000326

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000274 AC: 4 AN: 1460716 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 726640

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000756

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 8.99e-7

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0 AN: 152144 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 74314

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:9

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Hereditary cancer-predisposing syndrome Uncertain:4

Uncertain significance, criteria provided, single submitter	clinical testing	Color Diagnostics, LLC DBA Color Health	Mar 05, 2021	This variant results in an in-frame deletion of 10 amino acids in the Proline-rich domain of the TP53 protein. This variant is also known as p.78_88del in the literature. To our knowledge, functional studies have not been reported for this variant. This variant has been observed in two individuals affected with breast cancer (PMID: 31119730). This variant also has been identified in 6/250382 chromosomes (6/18390 East Asian chromosomes) in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. -
Uncertain significance, criteria provided, single submitter	clinical testing	Genome-Nilou Lab	Jun 18, 2022	- -
Uncertain significance, criteria provided, single submitter	curation	Sema4, Sema4	Sep 13, 2021	- -
Uncertain significance, criteria provided, single submitter	clinical testing	Ambry Genetics	Feb 23, 2024	The c.234_263del30 variant (also known as p.A79_A88del) is located in coding exon 3 of the TP53 gene. This variant results from an in-frame AGCTCCTACACCGGCGGCCCCTGCACCAGC deletion at nucleotide positions 234 to 263. This results in the in-frame deletion of 10 amino acids (APTPAAPAPA) at positions 79 to 88. In addition, the in silico prediction for this alteration is inconclusive (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -

Li-Fraumeni syndrome Uncertain:2

Uncertain significance, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Nov 04, 2023	This variant, c.234_263del, results in the deletion of 10 amino acid(s) of the TP53 protein (p.Ala79_Ala88del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs754312472, gnomAD 0.03%). This variant has been observed in individual(s) with breast cancer (PMID: 31119730). ClinVar contains an entry for this variant (Variation ID: 458529). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. RNA analysis performed to evaluate the impact of this variant on mRNA splicing indicates it does not significantly alter splicing (Invitae). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Uncertain significance, criteria provided, single submitter	clinical testing	Mendelics	Jul 02, 2018	- -

Li-Fraumeni syndrome 1 Uncertain:2

Uncertain significance, criteria provided, single submitter	clinical testing	MGZ Medical Genetics Center	Nov 09, 2021	- -
Uncertain significance, criteria provided, single submitter	clinical testing	Genome-Nilou Lab	Jun 18, 2022	- -

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

GeneDx

Jan 10, 2024

In-frame deletion of 10 amino acids in a non-repeat region; In silico analysis supports a deleterious effect on protein structure/function; Observed in individuals with breast cancer (PMID: 31119730); This variant is associated with the following publications: (PMID: 31119730, 35820297, 15510160) -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs754312472; hg19: chr17-7579423;