17-8228227-CTCGGATAGAAAGGCAGGACAA-C
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_025099.6(CTC1):c.3586_3606delTTGTCCTGCCTTTCTATCCGA(p.Leu1196_Arg1202del) variant causes a conservative inframe deletion change. The variant allele was found at a frequency of 0.000000684 in 1,461,864 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. L1196L) has been classified as Likely benign.
Frequency
Consequence
NM_025099.6 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- cerebroretinal microangiopathy with calcifications and cysts 1Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), PanelApp Australia, Ambry Genetics, G2P
- dyskeratosis congenitaInheritance: AR, AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
- Coats plus syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 exome AF: 6.84e-7 AC: 1AN: 1461864Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 727242 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
GnomAD4 genome Cov.: 31
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at