rs199473683

Variant names:

• chr17-8228227-CTCGGATAGAAAGGCAGGACAA-C
• rs199473683
• NM_025099.6:c.3586_3606delTTGTCCTGCCTTTCTATCCGA

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_025099.6(CTC1):​c.3586_3606delTTGTCCTGCCTTTCTATCCGA​(p.Leu1196_Arg1202del) variant causes a conservative inframe deletion change. The variant allele was found at a frequency of 0.000000684 in 1,461,864 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. L1196L) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 31)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
• Consequence: CTC1 NM_025099.6 conservative_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 4.48
• Publications: 0 publications found

Genes affected

CTC1 (HGNC:26169): (CST telomere replication complex component 1) This gene encodes a component of the CST complex. This complex plays an essential role in protecting telomeres from degradation. This protein also forms a heterodimer with the CST complex subunit STN1 to form the enzyme alpha accessory factor. This enzyme regulates DNA replication. Mutations in this gene are the cause of cerebroretinal microangiopathy with calcifications and cysts. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Mar 2012]

CTC1 Gene-Disease associations (from GenCC):

• cerebroretinal microangiopathy with calcifications and cysts 1

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), PanelApp Australia, Ambry Genetics, G2P
• dyskeratosis congenita

  Inheritance: AR, AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• Coats plus syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_025099.6.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CTC1	NM_025099.6	c.3586_3606delTTGTCCTGCCTTTCTATCCGA	p.Leu1196_Arg1202del	conservative_inframe_deletion	Exon 23 of 23	ENST00000651323.1	NP_079375.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CTC1	ENST00000651323.1	c.3586_3606delTTGTCCTGCCTTTCTATCCGA	p.Leu1196_Arg1202del	conservative_inframe_deletion	Exon 23 of 23		NM_025099.6	ENSP00000498499.1

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome AF: 6.84e-7 AC: 1 AN: 1461864 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 727242

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33480

American (AMR) AF: 0.00 AC: 0 AN: 44722

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26134

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86258

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53416

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5766

European-Non Finnish (NFE) AF: 8.99e-7 AC: 1 AN: 1111992

Other (OTH) AF: 0.00 AC: 0 AN: 60396

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 31

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.5
Mutation Taster		=19/181	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs199473683; hg19: chr17-8131545;