18-31498202-AGGCGGCGGCGCGGAGCGGTGC-A

Position:

• chr18-31498202-AGGCGGCGGCGCGGAGCGGTGC-A

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2

The NM_001943.5(DSG2):​c.-41_-21delCGCGGAGCGGTGCGGCGGCGG variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000568 in 1,232,216 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: 𝑓 0.000013 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000046 (0 hom.)
• Consequence: DSG2 NM_001943.5 5_prime_UTR
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.747

Genes affected

DSG2 (HGNC:3049): (desmoglein 2) This gene encodes a member of the desmoglein family and cadherin cell adhesion molecule superfamily of proteins. Desmogleins are calcium-binding transmembrane glycoprotein components of desmosomes, cell-cell junctions between epithelial, myocardial, and other cell types. The encoded preproprotein is proteolytically processed to generate the mature glycoprotein. This gene is present in a gene cluster with other desmoglein gene family members on chromosome 18. Mutations in this gene have been associated with arrhythmogenic right ventricular dysplasia, familial, 10. [provided by RefSeq, Jan 2016]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS2: High AC in GnomAdExome4 at 5 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
DSG2	NM_001943.5	c.-41_-21delCGCGGAGCGGTGCGGCGGCGG		5_prime_UTR_variant	1/15	ENST00000261590.13	NP_001934.2
DSG2	XM_047437315.1	c.-613_-593delCGCGGAGCGGTGCGGCGGCGG		5_prime_UTR_variant	1/16		XP_047293271.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
DSG2	ENST00000261590	c.-41_-21delCGCGGAGCGGTGCGGCGGCGG		5_prime_UTR_variant	1/15	1	NM_001943.5	ENSP00000261590.8

Frequencies

GnomAD3 genomes AF: 0.0000132 AC: 2 AN: 151678 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000415

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.00000463 AC: 5 AN: 1080430 Hom.: 0 AF XY: 0.00000391 AC XY: 2 AN XY: 512078

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.000203

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000109

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.0000132 AC: 2 AN: 151786 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 74214

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.000415

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

Bravo AF: 0.00000378

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Cardiomyopathy Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

CHEO Genetics Diagnostic Laboratory, Children's Hospital of Eastern Ontario

Oct 14, 2016

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs786204286; hg19: chr18-29078165;