18-31498226-CGGCGGGAGGCGGAGGCGAGGGTGCGAT-C

Position:

• chr18-31498226-CGGCGGGAGGCGGAGGCGAGGGTGCGAT-C

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PS1_Moderate PM2

The NM_001943.5(DSG2):​c.-21_6delGGAGGCGGAGGCGAGGGTGCGATGGCG​(p.Met1_Ala2del) variant causes a start lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: DSG2 NM_001943.5 start_lost, conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.85

Genes affected

DSG2 (HGNC:3049): (desmoglein 2) This gene encodes a member of the desmoglein family and cadherin cell adhesion molecule superfamily of proteins. Desmogleins are calcium-binding transmembrane glycoprotein components of desmosomes, cell-cell junctions between epithelial, myocardial, and other cell types. The encoded preproprotein is proteolytically processed to generate the mature glycoprotein. This gene is present in a gene cluster with other desmoglein gene family members on chromosome 18. Mutations in this gene have been associated with arrhythmogenic right ventricular dysplasia, familial, 10. [provided by RefSeq, Jan 2016]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Start lost variant, no new inframe start found.
• PS1: Another start lost variant in NM_001943.5 (DSG2) was described as [Pathogenic] in Lovd
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
DSG2	NM_001943.5	c.-21_6delGGAGGCGGAGGCGAGGGTGCGATGGCG	p.Met1_Ala2del	start_lost, conservative_inframe_deletion	1/15	ENST00000261590.13	NP_001934.2
DSG2	NM_001943.5	c.-21_6delGGAGGCGGAGGCGAGGGTGCGATGGCG		5_prime_UTR_variant	1/15	ENST00000261590.13	NP_001934.2
DSG2	XM_047437315.1	c.-593_-567delGGAGGCGGAGGCGAGGGTGCGATGGCG		5_prime_UTR_variant	1/16		XP_047293271.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
DSG2	ENST00000261590.13	c.-21_6delGGAGGCGGAGGCGAGGGTGCGATGGCG	p.Met1_Ala2del	start_lost, conservative_inframe_deletion	1/15	1	NM_001943.5	ENSP00000261590.8
DSG2	ENST00000261590	c.-21_6delGGAGGCGGAGGCGAGGGTGCGATGGCG		5_prime_UTR_variant	1/15	1	NM_001943.5	ENSP00000261590.8

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

CeGaT Center for Human Genetics Tuebingen

Dec 01, 2020

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs2072993600; hg19: chr18-29078189;