rs2072993600

Variant names:

• chr18-31498226-CGGCGGGAGGCGGAGGCGAGGGTGCGAT-C
• rs2072993600
• NM_001943.5:c.-21_6delGGAGGCGGAGGCGAGGGTGCGATGGCG

Your query was ambiguous. Multiple possible variants found:

• chr18-31498226-CGGCGGGAGGCGGAGGCGAGGGTGCGAT-C
• chr18-31498226-CGGCGGGAGGCGGAGGCGAGGGTGCGAT-CGGCGGGAGGCGGAGGCGAGGGTGCGATGGCGGGAGGCGGAGGCGAGGGTGCGAT

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_001943.5(DSG2):​c.-21_6delGGAGGCGGAGGCGAGGGTGCGATGGCG​(p.Met1_Ala2del) variant causes a start lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: DSG2 NM_001943.5 start_lost, conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.85
• Publications: 0 publications found

Genes affected

DSG2 (HGNC:3049): (desmoglein 2) This gene encodes a member of the desmoglein family and cadherin cell adhesion molecule superfamily of proteins. Desmogleins are calcium-binding transmembrane glycoprotein components of desmosomes, cell-cell junctions between epithelial, myocardial, and other cell types. The encoded preproprotein is proteolytically processed to generate the mature glycoprotein. This gene is present in a gene cluster with other desmoglein gene family members on chromosome 18. Mutations in this gene have been associated with arrhythmogenic right ventricular dysplasia, familial, 10. [provided by RefSeq, Jan 2016]

DSG2 Gene-Disease associations (from GenCC):

• arrhythmogenic right ventricular cardiomyopathy

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• arrhythmogenic right ventricular dysplasia 10

  Inheritance: AD, AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
• familial isolated dilated cardiomyopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• dilated cardiomyopathy

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen
• dilated cardiomyopathy 1BB

  Inheritance: AR Classification: LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Start lost variant, no new inframe start found.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001943.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DSG2	NM_001943.5	MANE Select	c.-21_6delGGAGGCGGAGGCGAGGGTGCGATGGCG	p.Met1_Ala2del	start_lost conservative_inframe_deletion	Exon 1 of 15	NP_001934.2	Q14126
	DSG2	NM_001943.5	MANE Select	c.-21_6delGGAGGCGGAGGCGAGGGTGCGATGGCG		5_prime_UTR	Exon 1 of 15	NP_001934.2	Q14126

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DSG2	ENST00000261590.13	TSL:1 MANE Select	c.-21_6delGGAGGCGGAGGCGAGGGTGCGATGGCG	p.Met1_Ala2del	start_lost conservative_inframe_deletion	Exon 1 of 15	ENSP00000261590.8	Q14126
	DSG2	ENST00000261590.13	TSL:1 MANE Select	c.-21_6delGGAGGCGGAGGCGAGGGTGCGATGGCG		5_prime_UTR	Exon 1 of 15	ENSP00000261590.8	Q14126
	DSG2	ENST00000713821.1		c.-21_6delGGAGGCGGAGGCGAGGGTGCGATGGCG	p.Met1_Ala2del	start_lost conservative_inframe_deletion	Exon 1 of 14	ENSP00000519125.1	A0AAQ5BGX8

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs2072993600; hg19: chr18-29078189;