18-51076682-G-GGCTACTGCACAAGCTGCAGCAGCTGCCC
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_005359.6(SMAD4):c.1354_1381dupGCTACTGCACAAGCTGCAGCAGCTGCCC(p.Gln461ArgfsTer42) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. Q461Q) has been classified as Benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_005359.6 frameshift
Scores
Clinical Significance
Conservation
Publications
- juvenile polyposis/hereditary hemorrhagic telangiectasia syndromeInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: ClinGen, PanelApp Australia, Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp
- Myhre syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, PanelApp Australia, G2P, Orphanet
- generalized juvenile polyposis/juvenile polyposis coliInheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
- juvenile polyposis syndromeInheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- familial thoracic aortic aneurysm and aortic dissectionInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- hereditary hemorrhagic telangiectasiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- pulmonary arterial hypertensionInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_005359.6. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SMAD4 | MANE Select | c.1354_1381dupGCTACTGCACAAGCTGCAGCAGCTGCCC | p.Gln461ArgfsTer42 | frameshift | Exon 11 of 12 | NP_005350.1 | Q13485 | ||
| SMAD4 | c.1354_1381dupGCTACTGCACAAGCTGCAGCAGCTGCCC | p.Gln461ArgfsTer42 | frameshift | Exon 11 of 12 | NP_001393970.1 | A0A024R274 | |||
| SMAD4 | c.1354_1381dupGCTACTGCACAAGCTGCAGCAGCTGCCC | p.Gln461ArgfsTer42 | frameshift | Exon 11 of 12 | NP_001393971.1 | Q13485 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SMAD4 | TSL:5 MANE Select | c.1354_1381dupGCTACTGCACAAGCTGCAGCAGCTGCCC | p.Gln461ArgfsTer42 | frameshift | Exon 11 of 12 | ENSP00000341551.3 | Q13485 | ||
| SMAD4 | TSL:1 | n.3355_3382dupGCTACTGCACAAGCTGCAGCAGCTGCCC | non_coding_transcript_exon | Exon 7 of 8 | |||||
| SMAD4 | c.1435_1462dupGCTACTGCACAAGCTGCAGCAGCTGCCC | p.Gln488ArgfsTer42 | frameshift | Exon 11 of 12 | ENSP00000519545.1 | A0AAQ5BHY6 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 30
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.