rs786204125

Variant names:

• chr18-51076682-G-GGCTACTGCACAAGCTGCAGCAGCTGCCC
• rs786204125
• NM_005359.6:c.1354_1381dupGCTACTGCACAAGCTGCAGCAGCTGCCC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_005359.6(SMAD4):​c.1354_1381dupGCTACTGCACAAGCTGCAGCAGCTGCCC​(p.Gln461ArgfsTer42) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: SMAD4 NM_005359.6 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 9.83

Genes affected

SMAD4 (HGNC:6770): (SMAD family member 4) This gene encodes a member of the Smad family of signal transduction proteins. Smad proteins are phosphorylated and activated by transmembrane serine-threonine receptor kinases in response to transforming growth factor (TGF)-beta signaling. The product of this gene forms homomeric complexes and heteromeric complexes with other activated Smad proteins, which then accumulate in the nucleus and regulate the transcription of target genes. This protein binds to DNA and recognizes an 8-bp palindromic sequence (GTCTAGAC) called the Smad-binding element (SBE). The protein acts as a tumor suppressor and inhibits epithelial cell proliferation. It may also have an inhibitory effect on tumors by reducing angiogenesis and increasing blood vessel hyperpermeability. The encoded protein is a crucial component of the bone morphogenetic protein signaling pathway. The Smad proteins are subject to complex regulation by post-translational modifications. Mutations or deletions in this gene have been shown to result in pancreatic cancer, juvenile polyposis syndrome, and hereditary hemorrhagic telangiectasia syndrome. [provided by RefSeq, May 2022]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 18-51076682-G-GGCTACTGCACAAGCTGCAGCAGCTGCCC is Pathogenic according to our data. Variant chr18-51076682-G-GGCTACTGCACAAGCTGCAGCAGCTGCCC is described in ClinVar as [Pathogenic]. Clinvar id is 188177.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SMAD4	NM_005359.6	c.1354_1381dupGCTACTGCACAAGCTGCAGCAGCTGCCC	p.Gln461ArgfsTer42	frameshift_variant	Exon 11 of 12	ENST00000342988.8	NP_005350.1
SMAD4	NM_001407041.1	c.1354_1381dupGCTACTGCACAAGCTGCAGCAGCTGCCC	p.Gln461ArgfsTer42	frameshift_variant	Exon 11 of 12		NP_001393970.1
SMAD4	NM_001407042.1	c.1354_1381dupGCTACTGCACAAGCTGCAGCAGCTGCCC	p.Gln461ArgfsTer42	frameshift_variant	Exon 11 of 12		NP_001393971.1
SMAD4	NR_176265.1	n.1892_1919dupGCTACTGCACAAGCTGCAGCAGCTGCCC		non_coding_transcript_exon_variant	Exon 11 of 13

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SMAD4	ENST00000342988.8	c.1354_1381dupGCTACTGCACAAGCTGCAGCAGCTGCCC	p.Gln461ArgfsTer42	frameshift_variant	Exon 11 of 12	5	NM_005359.6	ENSP00000341551.3

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 30

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, single submitter

Submissions by phenotype

Generalized juvenile polyposis/juvenile polyposis coli Pathogenic:1

Oct 25, 2014

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change inserts 28 nucleotides in exon 11 of the SMAD4 mRNA (c.1352_1354ins28), causing a frameshift at codon 461. This creates a premature translational stop signal (p.Gln461Argfs*42) and is expected to result in an absent or disrupted protein product. While this particular sequence change has not been reported in the literature, truncating sequence changes in SMAD4 are known to be pathogenic (PMID: 22810475). A different 28bp duplication in exon 11 has been reported in a patient with juvenile polyposis syndrome (JPS) (PMID: 23239472). For these reasons, this sequence change has been classified as Pathogenic. -

Juvenile polyposis syndrome Pathogenic:1

Oct 25, 2014

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change inserts 28 nucleotides in exon 11 of the SMAD4 mRNA (c.1352_1354ins28), causing a frameshift at codon 461. This creates a premature translational stop signal (p.Gln461Argfs*42) and is expected to result in an absent or disrupted protein product. While this particular sequence change has not been reported in the literature, truncating sequence changes in SMAD4 are known to be pathogenic (PMID: 22810475). For these reasons, this sequence change has been classified as Pathogenic. A different 28bp duplication in exon 11 has been reported in a patient with juvenile polyposis syndrome (JPS) (PMID: 23239472). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs786204125; hg19: chr18-48603052;