18-55586153-GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC-G

Variant names:

• chr18-55586153-GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC-G
• rs55725917
• NM_001083962.2:c.73-837_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BS1 BS2

The NM_001083962.2(TCF4):​c.73-837_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00374 in 707,800 control chromosomes in the GnomAD database, including 47 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0078 (9 hom., cov: 0)
  • Exomes 𝑓: 0.0028 (38 hom.)
• Consequence: TCF4 NM_001083962.2 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.885
• Publications: 0 publications found

Genes affected

TCF4 (HGNC:11634): (transcription factor 4) This gene encodes transcription factor 4, a basic helix-loop-helix transcription factor. The encoded protein recognizes an Ephrussi-box ('E-box') binding site ('CANNTG') - a motif first identified in immunoglobulin enhancers. This gene is broadly expressed, and may play an important role in nervous system development. Defects in this gene are a cause of Pitt-Hopkins syndrome. In addition, an intronic CTG repeat normally numbering 10-37 repeat units can expand to >50 repeat units and cause Fuchs endothelial corneal dystrophy. Multiple alternatively spliced transcript variants that encode different proteins have been described. [provided by RefSeq, Jul 2016]

TCF4 Gene-Disease associations (from GenCC):

• Pitt-Hopkins syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, PanelApp Australia, Orphanet, Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae)
• corneal dystrophy, Fuchs endothelial, 3

  Inheritance: AD Classification: STRONG Submitted by: G2P
• autosomal dominant non-syndromic intellectual disability

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Fuchs' endothelial dystrophy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• autism spectrum disorder

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
• intellectual disability

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• BS1: Variant frequency is greater than expected in population eas. GnomAd4 allele frequency = 0.00781 (1059/135528) while in subpopulation EAS AF = 0.0374 (164/4380). AF 95% confidence interval is 0.0328. There are 9 homozygotes in GnomAd4. There are 537 alleles in the male GnomAd4 subpopulation. Median coverage is 0. This position passed quality control check.
• BS2: High AC in GnomAd4 at 1059 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001083962.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TCF4	NM_001083962.2	MANE Select	c.73-837_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	NP_001077431.1	P15884-3
	TCF4	NM_001243226.3		c.379-837_379-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	NP_001230155.2	E9PH57
	TCF4	NM_001243228.2		c.73-837_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	NP_001230157.1	H3BTP3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TCF4	ENST00000354452.8	TSL:5 MANE Select	c.73-837_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	ENSP00000346440.3	P15884-3
	TCF4	ENST00000398339.5	TSL:1	c.379-837_379-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	ENSP00000381382.1	E9PH57
	TCF4	ENST00000356073.8	TSL:1	c.73-837_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	ENSP00000348374.4	P15884-1

Frequencies

GnomAD3 genomes AF: 0.00780 AC: 1056 AN: 135436 Hom.: 9 Cov.: 0

Gnomad AFR AF: 0.00967

Gnomad AMI AF: 0.00119

Gnomad AMR AF: 0.00580

Gnomad ASJ AF: 0.00346

Gnomad EAS AF: 0.0374

Gnomad SAS AF: 0.0123

Gnomad FIN AF: 0.00208

Gnomad MID AF: 0.00993

Gnomad NFE AF: 0.00581

Gnomad OTH AF: 0.00808

GnomAD4 exome AF: 0.00278 AC: 1590 AN: 572272 Hom.: 38 AF XY: 0.00318 AC XY: 951 AN XY: 298966

African (AFR) AF: 0.00244 AC: 44 AN: 18008

American (AMR) AF: 0.00282 AC: 62 AN: 21998

Ashkenazi Jewish (ASJ) AF: 0.000939 AC: 14 AN: 14912

East Asian (EAS) AF: 0.0131 AC: 315 AN: 24002

South Asian (SAS) AF: 0.00758 AC: 403 AN: 53182

European-Finnish (FIN) AF: 0.000771 AC: 18 AN: 23356

Middle Eastern (MID) AF: 0.00740 AC: 18 AN: 2434

European-Non Finnish (NFE) AF: 0.00169 AC: 654 AN: 386630

Other (OTH) AF: 0.00223 AC: 62 AN: 27750

GnomAD4 genome AF: 0.00781 AC: 1059 AN: 135528 Hom.: 9 Cov.: 0 AF XY: 0.00819 AC XY: 537 AN XY: 65542

African (AFR) AF: 0.00975 AC: 367 AN: 37658

American (AMR) AF: 0.00580 AC: 75 AN: 12940

Ashkenazi Jewish (ASJ) AF: 0.00346 AC: 11 AN: 3176

East Asian (EAS) AF: 0.0374 AC: 164 AN: 4380

South Asian (SAS) AF: 0.0120 AC: 48 AN: 3988

European-Finnish (FIN) AF: 0.00208 AC: 19 AN: 9126

Middle Eastern (MID) AF: 0.0107 AC: 3 AN: 280

European-Non Finnish (NFE) AF: 0.00579 AC: 355 AN: 61266

Other (OTH) AF: 0.00853 AC: 16 AN: 1876

Alfa AF: 0.00 Hom.: 287

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.89
Mutation Taster		=100/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs55725917; hg19: chr18-53253384;