NM_001083962.2:c.73-837_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT

Variant names:

• chr18-55586153-GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC-G
• rs55725917
• NM_001083962.2:c.73-837_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 0P and 8B. BS1 BS2

The NM_001083962.2(TCF4):​c.73-837_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00374 in 707,800 control chromosomes in the GnomAD database, including 47 homozygotes. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0078 (9 hom., cov: 0)
  • Exomes 𝑓: 0.0028 (38 hom.)
• Consequence: TCF4 NM_001083962.2 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.885

Genes affected

TCF4 (HGNC:11634): (transcription factor 4) This gene encodes transcription factor 4, a basic helix-loop-helix transcription factor. The encoded protein recognizes an Ephrussi-box ('E-box') binding site ('CANNTG') - a motif first identified in immunoglobulin enhancers. This gene is broadly expressed, and may play an important role in nervous system development. Defects in this gene are a cause of Pitt-Hopkins syndrome. In addition, an intronic CTG repeat normally numbering 10-37 repeat units can expand to >50 repeat units and cause Fuchs endothelial corneal dystrophy. Multiple alternatively spliced transcript variants that encode different proteins have been described. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• BS1: Variant frequency is greater than expected in population eas. gnomad4 allele frequency = 0.00781 (1059/135528) while in subpopulation EAS AF= 0.0374 (164/4380). AF 95% confidence interval is 0.0328. There are 9 homozygotes in gnomad4. There are 537 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 1059 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TCF4	NM_001083962.2	c.73-837_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT		intron_variant	Intron 2 of 19	ENST00000354452.8	NP_001077431.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TCF4	ENST00000354452.8	c.73-837_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT		intron_variant	Intron 2 of 19	5	NM_001083962.2	ENSP00000346440.3

Frequencies

GnomAD3 genomes AF: 0.00780 AC: 1056 AN: 135436 Hom.: 9 Cov.: 0

Gnomad AFR AF: 0.00967

Gnomad AMI AF: 0.00119

Gnomad AMR AF: 0.00580

Gnomad ASJ AF: 0.00346

Gnomad EAS AF: 0.0374

Gnomad SAS AF: 0.0123

Gnomad FIN AF: 0.00208

Gnomad MID AF: 0.00993

Gnomad NFE AF: 0.00581

Gnomad OTH AF: 0.00808

GnomAD4 exome AF: 0.00278 AC: 1590 AN: 572272 Hom.: 38 AF XY: 0.00318 AC XY: 951 AN XY: 298966

Gnomad4 AFR exome AF: 0.00244

Gnomad4 AMR exome AF: 0.00282

Gnomad4 ASJ exome AF: 0.000939

Gnomad4 EAS exome AF: 0.0131

Gnomad4 SAS exome AF: 0.00758

Gnomad4 FIN exome AF: 0.000771

Gnomad4 NFE exome AF: 0.00169

Gnomad4 OTH exome AF: 0.00223

GnomAD4 genome AF: 0.00781 AC: 1059 AN: 135528 Hom.: 9 Cov.: 0 AF XY: 0.00819 AC XY: 537 AN XY: 65542

Gnomad4 AFR AF: 0.00975

Gnomad4 AMR AF: 0.00580

Gnomad4 ASJ AF: 0.00346

Gnomad4 EAS AF: 0.0374

Gnomad4 SAS AF: 0.0120

Gnomad4 FIN AF: 0.00208

Gnomad4 NFE AF: 0.00579

Gnomad4 OTH AF: 0.00853

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs55725917; hg19: chr18-53253384;