18-55586153-GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC-GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC

Variant names:

• chr18-55586153-GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC-G
• rs55725917
• NM_001083962.2:c.73-834_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 0P and 8B. BS1 BS2

The NM_001083962.2(TCF4):​c.73-834_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00524 in 705,768 control chromosomes in the GnomAD database, including 63 homozygotes. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.011 (19 hom., cov: 0)
  • Exomes 𝑓: 0.0039 (44 hom.)
• Consequence: TCF4 NM_001083962.2 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.885

Genes affected

TCF4 (HGNC:11634): (transcription factor 4) This gene encodes transcription factor 4, a basic helix-loop-helix transcription factor. The encoded protein recognizes an Ephrussi-box ('E-box') binding site ('CANNTG') - a motif first identified in immunoglobulin enhancers. This gene is broadly expressed, and may play an important role in nervous system development. Defects in this gene are a cause of Pitt-Hopkins syndrome. In addition, an intronic CTG repeat normally numbering 10-37 repeat units can expand to >50 repeat units and cause Fuchs endothelial corneal dystrophy. Multiple alternatively spliced transcript variants that encode different proteins have been described. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• BS1: Variant frequency is greater than expected in population afr. gnomad4 allele frequency = 0.0108 (1468/135520) while in subpopulation AFR AF= 0.0229 (863/37656). AF 95% confidence interval is 0.0216. There are 19 homozygotes in gnomad4. There are 665 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 1468 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TCF4	NM_001083962.2	c.73-834_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT		intron_variant	Intron 2 of 19	ENST00000354452.8	NP_001077431.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TCF4	ENST00000354452.8	c.73-834_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT		intron_variant	Intron 2 of 19	5	NM_001083962.2	ENSP00000346440.3

Frequencies

GnomAD3 genomes AF: 0.0108 AC: 1466 AN: 135428 Hom.: 19 Cov.: 0

Gnomad AFR AF: 0.0229

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00727

Gnomad ASJ AF: 0.000630

Gnomad EAS AF: 0.00273

Gnomad SAS AF: 0.00301

Gnomad FIN AF: 0.00252

Gnomad MID AF: 0.00329

Gnomad NFE AF: 0.00723

Gnomad OTH AF: 0.00971

GnomAD4 exome AF: 0.00392 AC: 2233 AN: 570248 Hom.: 44 AF XY: 0.00393 AC XY: 1170 AN XY: 297982

Gnomad4 AFR exome AF: 0.00926

Gnomad4 AMR exome AF: 0.00383

Gnomad4 ASJ exome AF: 0.00128

Gnomad4 EAS exome AF: 0.00154

Gnomad4 SAS exome AF: 0.00243

Gnomad4 FIN exome AF: 0.00588

Gnomad4 NFE exome AF: 0.00396

Gnomad4 OTH exome AF: 0.00474

GnomAD4 genome AF: 0.0108 AC: 1468 AN: 135520 Hom.: 19 Cov.: 0 AF XY: 0.0101 AC XY: 665 AN XY: 65542

Gnomad4 AFR AF: 0.0229

Gnomad4 AMR AF: 0.00726

Gnomad4 ASJ AF: 0.000630

Gnomad4 EAS AF: 0.00274

Gnomad4 SAS AF: 0.00301

Gnomad4 FIN AF: 0.00252

Gnomad4 NFE AF: 0.00723

Gnomad4 OTH AF: 0.00961

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs55725917; hg19: chr18-53253384;