18-55586153-GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC-GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC

Variant names:

• chr18-55586153-GAGC-G
• rs55725917
• NM_001083962.2:c.73-804_73-802delGCT

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 0P and 8B. BA1

The NM_001083962.2(TCF4):​c.73-804_73-802delGCT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0221 in 702,900 control chromosomes in the GnomAD database, including 277 homozygotes. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.023 (24 hom., cov: 0)
  • Exomes 𝑓: 0.022 (253 hom.)
• Consequence: TCF4 NM_001083962.2 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.00

Genes affected

TCF4 (HGNC:11634): (transcription factor 4) This gene encodes transcription factor 4, a basic helix-loop-helix transcription factor. The encoded protein recognizes an Ephrussi-box ('E-box') binding site ('CANNTG') - a motif first identified in immunoglobulin enhancers. This gene is broadly expressed, and may play an important role in nervous system development. Defects in this gene are a cause of Pitt-Hopkins syndrome. In addition, an intronic CTG repeat normally numbering 10-37 repeat units can expand to >50 repeat units and cause Fuchs endothelial corneal dystrophy. Multiple alternatively spliced transcript variants that encode different proteins have been described. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• BA1: GnomAdExome4 highest subpopulation (EAS) allele frequency at 95% confidence interval = 0.0788 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TCF4	NM_001083962.2	c.73-804_73-802delGCT		intron_variant	Intron 2 of 19	ENST00000354452.8	NP_001077431.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TCF4	ENST00000354452.8	c.73-804_73-802delGCT		intron_variant	Intron 2 of 19	5	NM_001083962.2	ENSP00000346440.3

Frequencies

GnomAD3 genomes AF: 0.0227 AC: 3075 AN: 135234 Hom.: 24 Cov.: 0

Gnomad AFR AF: 0.0294

Gnomad AMI AF: 0.0167

Gnomad AMR AF: 0.0166

Gnomad ASJ AF: 0.0319

Gnomad EAS AF: 0.0459

Gnomad SAS AF: 0.0408

Gnomad FIN AF: 0.0104

Gnomad MID AF: 0.0362

Gnomad NFE AF: 0.0184

Gnomad OTH AF: 0.0270

GnomAD4 exome AF: 0.0220 AC: 12464 AN: 567574 Hom.: 253 AF XY: 0.0235 AC XY: 6972 AN XY: 296492

Gnomad4 AFR exome AF: 0.0253

Gnomad4 AMR exome AF: 0.0151

Gnomad4 ASJ exome AF: 0.0311

Gnomad4 EAS exome AF: 0.0818

Gnomad4 SAS exome AF: 0.0419

Gnomad4 FIN exome AF: 0.0150

Gnomad4 NFE exome AF: 0.0154

Gnomad4 OTH exome AF: 0.0276

GnomAD4 genome AF: 0.0227 AC: 3078 AN: 135326 Hom.: 24 Cov.: 0 AF XY: 0.0227 AC XY: 1485 AN XY: 65444

Gnomad4 AFR AF: 0.0294

Gnomad4 AMR AF: 0.0166

Gnomad4 ASJ AF: 0.0319

Gnomad4 EAS AF: 0.0460

Gnomad4 SAS AF: 0.0405

Gnomad4 FIN AF: 0.0104

Gnomad4 NFE AF: 0.0184

Gnomad4 OTH AF: 0.0272

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Name	Calibrated prediction	Score	Prediction
SpliceAI score (max)		0.0		Details are displayed if max score is > 0.2

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs55725917; hg19: chr18-53253384;