18-55586153-GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC-GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC

Variant names:

• chr18-55586153-G-GAGCAGCAGCAGCAGCAGCAGC
• rs55725917
• NM_001083962.2:c.73-822_73-802dupGCTGCTGCTGCTGCTGCTGCT

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 0P and 8B. BS1 BS2

The NM_001083962.2(TCF4):​c.73-822_73-802dupGCTGCTGCTGCTGCTGCTGCT variant causes a intron change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0066 (18 hom., cov: 0)
  • Exomes 𝑓: 0.0064 (103 hom.)
  • Failed GnomAD Quality Control
• Consequence: TCF4 NM_001083962.2 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.00

Genes affected

TCF4 (HGNC:11634): (transcription factor 4) This gene encodes transcription factor 4, a basic helix-loop-helix transcription factor. The encoded protein recognizes an Ephrussi-box ('E-box') binding site ('CANNTG') - a motif first identified in immunoglobulin enhancers. This gene is broadly expressed, and may play an important role in nervous system development. Defects in this gene are a cause of Pitt-Hopkins syndrome. In addition, an intronic CTG repeat normally numbering 10-37 repeat units can expand to >50 repeat units and cause Fuchs endothelial corneal dystrophy. Multiple alternatively spliced transcript variants that encode different proteins have been described. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• BS1: Variant frequency is greater than expected in population eas. gnomad4 allele frequency = 0.00665 (901/135526) while in subpopulation EAS AF= 0.00685 (30/4382). AF 95% confidence interval is 0.00572. There are 18 homozygotes in gnomad4. There are 454 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 901 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TCF4	NM_001083962.2	c.73-822_73-802dupGCTGCTGCTGCTGCTGCTGCT		intron_variant	Intron 2 of 19	ENST00000354452.8	NP_001077431.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TCF4	ENST00000354452.8	c.73-822_73-802dupGCTGCTGCTGCTGCTGCTGCT		intron_variant	Intron 2 of 19	5	NM_001083962.2	ENSP00000346440.3

Frequencies

GnomAD3 genomes AF: 0.00665 AC: 901 AN: 135432 Hom.: 18 Cov.: 0

Gnomad AFR AF: 0.00437

Gnomad AMI AF: 0.0859

Gnomad AMR AF: 0.00557

Gnomad ASJ AF: 0.0116

Gnomad EAS AF: 0.00683

Gnomad SAS AF: 0.00426

Gnomad FIN AF: 0.0125

Gnomad MID AF: 0.00329

Gnomad NFE AF: 0.00623

Gnomad OTH AF: 0.00647

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00635 AC: 3634 AN: 572050 Hom.: 103 Cov.: 0 AF XY: 0.00624 AC XY: 1864 AN XY: 298862

Gnomad4 AFR exome AF: 0.00416

Gnomad4 AMR exome AF: 0.00655

Gnomad4 ASJ exome AF: 0.0128

Gnomad4 EAS exome AF: 0.00861

Gnomad4 SAS exome AF: 0.00510

Gnomad4 FIN exome AF: 0.0199

Gnomad4 NFE exome AF: 0.00535

Gnomad4 OTH exome AF: 0.00743

GnomAD4 genome AF: 0.00665 AC: 901 AN: 135526 Hom.: 18 Cov.: 0 AF XY: 0.00693 AC XY: 454 AN XY: 65540

Gnomad4 AFR AF: 0.00433

Gnomad4 AMR AF: 0.00556

Gnomad4 ASJ AF: 0.0116

Gnomad4 EAS AF: 0.00685

Gnomad4 SAS AF: 0.00452

Gnomad4 FIN AF: 0.0125

Gnomad4 NFE AF: 0.00624

Gnomad4 OTH AF: 0.00640

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs55725917; hg19: chr18-53253384;