18-62325386-T-TTCGCGCTGCTGCTGCTCTGCGCGCTGC

Variant names:

• chr18-62325386-T-TTCGCGCTGCTGCTGCTCTGCGCGCTGC
• rs796051862
• NM_003839.4:c.39_65dupGCTGCTGCTGCTCTGCGCGCTGCTCGC

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PP5_Moderate

The NM_003839.4(TNFRSF11A):​c.39_65dupGCTGCTGCTGCTCTGCGCGCTGCTCGC​(p.Ala22_Arg23insLeuLeuLeuLeuCysAlaLeuLeuAla) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: TNFRSF11A NM_003839.4 disruptive_inframe_insertion
• Clinical Significance: Pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: -0.0820

Genes affected

TNFRSF11A (HGNC:11908): (TNF receptor superfamily member 11a) The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptors can interact with various TRAF family proteins, through which this receptor induces the activation of NF-kappa B and MAPK8/JNK. This receptor and its ligand are important regulators of the interaction between T cells and dendritic cells. This receptor is also an essential mediator for osteoclast and lymph node development. Mutations at this locus have been associated with familial expansile osteolysis, autosomal recessive osteopetrosis, and Paget disease of bone. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Aug 2012]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 18-62325386-T-TTCGCGCTGCTGCTGCTCTGCGCGCTGC is Pathogenic according to our data. Variant chr18-62325386-T-TTCGCGCTGCTGCTGCTCTGCGCGCTGC is described in ClinVar as [Pathogenic]. Clinvar id is 6300.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TNFRSF11A	NM_003839.4	c.39_65dupGCTGCTGCTGCTCTGCGCGCTGCTCGC	p.Ala22_Arg23insLeuLeuLeuLeuCysAlaLeuLeuAla	disruptive_inframe_insertion	Exon 1 of 10	ENST00000586569.3	NP_003830.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TNFRSF11A	ENST00000586569.3	c.39_65dupGCTGCTGCTGCTCTGCGCGCTGCTCGC	p.Ala22_Arg23insLeuLeuLeuLeuCysAlaLeuLeuAla	disruptive_inframe_insertion	Exon 1 of 10	1	NM_003839.4	ENSP00000465500.1
TNFRSF11A	ENST00000269485.11	c.39_65dupGCTGCTGCTGCTCTGCGCGCTGCTCGC	p.Ala22_Arg23insLeuLeuLeuLeuCysAlaLeuLeuAla	disruptive_inframe_insertion	Exon 1 of 7	1		ENSP00000269485.7
TNFRSF11A	ENST00000592013.1	n.66_92dupGCTGCTGCTGCTCTGCGCGCTGCTCGC		non_coding_transcript_exon_variant	Exon 1 of 2	2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 30

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Aug 31, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.39_65dup, results in the insertion of 9 amino acid(s) of the TNFRSF11A protein (p.Leu14_Ala22dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individuals with autosomal dominant expansile osteolytic syndromes (PMID: 10615125, 31923705; Invitae). It has also been observed to segregate with disease in related individuals. Experimental studies have shown that this variant affects TNFRSF11A function (PMID: 10615125, 21472776). This variant is also known as 75dup27 and 77dup27. ClinVar contains an entry for this variant (Variation ID: 6300). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. For these reasons, this variant has been classified as Pathogenic. -

Paget disease of bone 2, early-onset Pathogenic:1

Jan 01, 2000

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs796051862; hg19: chr18-59992619;