rs796051862

Variant names:

• chr18-62325386-T-TTCGCGCTGCTGCTGCTCTGCGCGCTGC
• rs796051862
• NM_003839.4:c.39_65dupGCTGCTGCTGCTCTGCGCGCTGCTCGC

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 6P and 1B. PS3 PP5_Moderate BP3

The NM_003839.4(TNFRSF11A):​c.39_65dupGCTGCTGCTGCTCTGCGCGCTGCTCGC​(p.Ala22_Arg23insLeuLeuLeuLeuCysAlaLeuLeuAla) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). ClinVar reports functional evidence for this variant: "SCV001588345: Experimental studies have shown that this variant affects TNFRSF11A function (PMID:10615125, 21472776).".

• Frequency: Genomes: not found (cov: 32)
• Consequence: TNFRSF11A NM_003839.4 disruptive_inframe_insertion
• Clinical Significance: Pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: -0.0820
• Publications: 0 publications found

Genes affected

TNFRSF11A (HGNC:11908): (TNF receptor superfamily member 11a) The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptors can interact with various TRAF family proteins, through which this receptor induces the activation of NF-kappa B and MAPK8/JNK. This receptor and its ligand are important regulators of the interaction between T cells and dendritic cells. This receptor is also an essential mediator for osteoclast and lymph node development. Mutations at this locus have been associated with familial expansile osteolysis, autosomal recessive osteopetrosis, and Paget disease of bone. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Aug 2012]

TNFRSF11A Gene-Disease associations (from GenCC):

• Paget disease of bone 2, early-onset

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• autosomal recessive osteopetrosis 7

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: PanelApp Australia, Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, Genomics England PanelApp
• familial expansile osteolysis

  Inheritance: AD Classification: MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet
• dysosteosclerosis

  Inheritance: AR Classification: SUPPORTIVE, LIMITED Submitted by: Orphanet, Ambry Genetics
• osteosarcoma

  Inheritance: AD Classification: LIMITED Submitted by: Genomics England PanelApp

ACMG classification

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

• PS3: PS3 evidence extracted from ClinVar submissions: SCV001588345: Experimental studies have shown that this variant affects TNFRSF11A function (PMID: 10615125, 21472776).
• PP5: Variant 18-62325386-T-TTCGCGCTGCTGCTGCTCTGCGCGCTGC is Pathogenic according to our data. Variant chr18-62325386-T-TTCGCGCTGCTGCTGCTCTGCGCGCTGC is described in ClinVar as Pathogenic. ClinVar VariationId is 6300.Status of the report is criteria_provided_single_submitter, 1 stars.
• BP3: Nonframeshift variant in repetitive region in NM_003839.4

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_003839.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TNFRSF11A	NM_003839.4	MANE Select	c.39_65dupGCTGCTGCTGCTCTGCGCGCTGCTCGC	p.Ala22_Arg23insLeuLeuLeuLeuCysAlaLeuLeuAla	disruptive_inframe_insertion	Exon 1 of 10	NP_003830.1	Q9Y6Q6-1
	TNFRSF11A	NM_001278268.2		c.39_65dupGCTGCTGCTGCTCTGCGCGCTGCTCGC	p.Ala22_Arg23insLeuLeuLeuLeuCysAlaLeuLeuAla	disruptive_inframe_insertion	Exon 1 of 10	NP_001265197.1	Q9Y6Q6-6
	TNFRSF11A	NM_001270950.2		c.39_65dupGCTGCTGCTGCTCTGCGCGCTGCTCGC	p.Ala22_Arg23insLeuLeuLeuLeuCysAlaLeuLeuAla	disruptive_inframe_insertion	Exon 1 of 8	NP_001257879.1	Q9Y6Q6-3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TNFRSF11A	ENST00000586569.3	TSL:1 MANE Select	c.39_65dupGCTGCTGCTGCTCTGCGCGCTGCTCGC	p.Ala22_Arg23insLeuLeuLeuLeuCysAlaLeuLeuAla	disruptive_inframe_insertion	Exon 1 of 10	ENSP00000465500.1	Q9Y6Q6-1
	TNFRSF11A	ENST00000269485.11	TSL:1	c.39_65dupGCTGCTGCTGCTCTGCGCGCTGCTCGC	p.Ala22_Arg23insLeuLeuLeuLeuCysAlaLeuLeuAla	disruptive_inframe_insertion	Exon 1 of 7	ENSP00000269485.7	Q9Y6Q6-2
	TNFRSF11A	ENST00000903844.1		c.39_65dupGCTGCTGCTGCTCTGCGCGCTGCTCGC	p.Ala22_Arg23insLeuLeuLeuLeuCysAlaLeuLeuAla	disruptive_inframe_insertion	Exon 1 of 10	ENSP00000573903.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 30

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	not provided (1)
1	-	-	Paget disease of bone 2, early-onset (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.082
Mutation Taster		=83/17	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs796051862;

hg19: chr18-59992619;