18-657645-ACCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCG-ACCGCGCCACTTGGCCTGCCTCCGTCCCG

Position:

• chr18-657645-ACCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCG-ACCGCGCCACTTGGCCTGCCTCCGTCCCG

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 0P and 8B. BA1

The ENST00000323274(TYMS):​c.-58_-31delGGCCTGCCTCCGTCCCGCCGCGCCACTT variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.304 in 997,140 control chromosomes in the GnomAD database, including 79,792 homozygotes. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.42 (13516 hom., cov: 0)
  • Exomes 𝑓: 0.28 (66276 hom.)
• Consequence: TYMS ENST00000323274 5_prime_UTR
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.424

Genes affected

TYMS (HGNC:12441): (thymidylate synthetase) Thymidylate synthase catalyzes the methylation of deoxyuridylate to deoxythymidylate using, 10-methylenetetrahydrofolate (methylene-THF) as a cofactor. This function maintains the dTMP (thymidine-5-prime monophosphate) pool critical for DNA replication and repair. The enzyme has been of interest as a target for cancer chemotherapeutic agents. It is considered to be the primary site of action for 5-fluorouracil, 5-fluoro-2-prime-deoxyuridine, and some folate analogs. Expression of this gene and that of a naturally occurring antisense transcript, mitochondrial enolase superfamily member 1 (GeneID:55556), vary inversely when cell-growth progresses from late-log to plateau phase. Polymorphisms in this gene may be associated with etiology of neoplasia, including breast cancer, and response to chemotherapy. [provided by RefSeq, Aug 2017]

TYMSOS (HGNC:):

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• BA1: GnomAd4 highest subpopulation (NFE) allele frequency at 95% confidence interval = 0.436 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
TYMS	NM_001071.4	c.-58_-31delGGCCTGCCTCCGTCCCGCCGCGCCACTT		5_prime_UTR_variant	1/7	ENST00000323274.15	NP_001062.1
TYMS	NM_001071.4	c.-97_-70delCCGCGCCACTTGGCCTGCCTCCGTCCCG		upstream_gene_variant		ENST00000323274.15	NP_001062.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
TYMS	ENST00000323274	c.-58_-31delGGCCTGCCTCCGTCCCGCCGCGCCACTT		5_prime_UTR_variant	1/7	1	NM_001071.4	ENSP00000315644.10
TYMS	ENST00000323274.15	c.-97_-70delCCGCGCCACTTGGCCTGCCTCCGTCCCG		upstream_gene_variant		1	NM_001071.4	ENSP00000315644.10

Frequencies

GnomAD3 genomes AF: 0.415 AC: 61443 AN: 147948 Hom.: 13507 Cov.: 0

Gnomad AFR AF: 0.392

Gnomad AMI AF: 0.556

Gnomad AMR AF: 0.391

Gnomad ASJ AF: 0.442

Gnomad EAS AF: 0.158

Gnomad SAS AF: 0.351

Gnomad FIN AF: 0.513

Gnomad MID AF: 0.403

Gnomad NFE AF: 0.440

Gnomad OTH AF: 0.422

GnomAD4 exome AF: 0.284 AC: 241485 AN: 849088 Hom.: 66276 AF XY: 0.287 AC XY: 119801 AN XY: 416870

Gnomad4 AFR exome AF: 0.265

Gnomad4 AMR exome AF: 0.361

Gnomad4 ASJ exome AF: 0.346

Gnomad4 EAS exome AF: 0.147

Gnomad4 SAS exome AF: 0.211

Gnomad4 FIN exome AF: 0.469

Gnomad4 NFE exome AF: 0.283

Gnomad4 OTH exome AF: 0.302

GnomAD4 genome AF: 0.415 AC: 61467 AN: 148052 Hom.: 13516 Cov.: 0 AF XY: 0.413 AC XY: 29839 AN XY: 72278

Gnomad4 AFR AF: 0.392

Gnomad4 AMR AF: 0.391

Gnomad4 ASJ AF: 0.442

Gnomad4 EAS AF: 0.158

Gnomad4 SAS AF: 0.352

Gnomad4 FIN AF: 0.513

Gnomad4 NFE AF: 0.440

Gnomad4 OTH AF: 0.416

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs45445694; hg19: chr18-657645;