chr18-657645-ACCGCGCCACTTGGCCTGCCTCCGTCCCG-A

Variant names:

• chr18-657645-ACCGCGCCACTTGGCCTGCCTCCGTCCCG-A
• rs45445694
• NM_001071.4:c.-58_-31delGGCCTGCCTCCGTCCCGCCGCGCCACTT

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BA1

The NM_001071.4(TYMS):​c.-58_-31delGGCCTGCCTCCGTCCCGCCGCGCCACTT variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.304 in 997,140 control chromosomes in the GnomAD database, including 79,792 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.42 (13516 hom., cov: 0)
  • Exomes 𝑓: 0.28 (66276 hom.)
• Consequence: TYMS NM_001071.4 5_prime_UTR
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.424
• Publications: 51 publications found

Genes affected

TYMS (HGNC:12441): (thymidylate synthetase) Thymidylate synthase catalyzes the methylation of deoxyuridylate to deoxythymidylate using, 10-methylenetetrahydrofolate (methylene-THF) as a cofactor. This function maintains the dTMP (thymidine-5-prime monophosphate) pool critical for DNA replication and repair. The enzyme has been of interest as a target for cancer chemotherapeutic agents. It is considered to be the primary site of action for 5-fluorouracil, 5-fluoro-2-prime-deoxyuridine, and some folate analogs. Expression of this gene and that of a naturally occurring antisense transcript, mitochondrial enolase superfamily member 1 (GeneID:55556), vary inversely when cell-growth progresses from late-log to plateau phase. Polymorphisms in this gene may be associated with etiology of neoplasia, including breast cancer, and response to chemotherapy. [provided by RefSeq, Aug 2017]

TYMSOS (HGNC:29553): (TYMS opposite strand RNA)

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• BA1: GnomAd4 highest subpopulation (NFE) allele frequency at 95% confidence interval = 0.436 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TYMS	NM_001071.4	c.-58_-31delGGCCTGCCTCCGTCCCGCCGCGCCACTT		5_prime_UTR_variant	Exon 1 of 7	ENST00000323274.15	NP_001062.1
TYMS	NM_001071.4	c.-97_-70delCCGCGCCACTTGGCCTGCCTCCGTCCCG		upstream_gene_variant		ENST00000323274.15	NP_001062.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TYMS	ENST00000323274.15	c.-97_-70delCCGCGCCACTTGGCCTGCCTCCGTCCCG		5_prime_UTR_variant	Exon 1 of 7	1	NM_001071.4	ENSP00000315644.10
TYMS	ENST00000323274.15	c.-97_-70delCCGCGCCACTTGGCCTGCCTCCGTCCCG		non_coding_transcript_variant		1	NM_001071.4	ENSP00000315644.10
TYMS	ENST00000323274.15	c.-97_-70delCCGCGCCACTTGGCCTGCCTCCGTCCCG		upstream_gene_variant		1	NM_001071.4	ENSP00000315644.10

Frequencies

GnomAD3 genomes AF: 0.415 AC: 61443 AN: 147948 Hom.: 13507 Cov.: 0

Gnomad AFR AF: 0.392

Gnomad AMI AF: 0.556

Gnomad AMR AF: 0.391

Gnomad ASJ AF: 0.442

Gnomad EAS AF: 0.158

Gnomad SAS AF: 0.351

Gnomad FIN AF: 0.513

Gnomad MID AF: 0.403

Gnomad NFE AF: 0.440

Gnomad OTH AF: 0.422

GnomAD4 exome AF: 0.284 AC: 241485 AN: 849088 Hom.: 66276 AF XY: 0.287 AC XY: 119801 AN XY: 416870

African (AFR) AF: 0.265 AC: 4294 AN: 16176

American (AMR) AF: 0.361 AC: 2699 AN: 7472

Ashkenazi Jewish (ASJ) AF: 0.346 AC: 4455 AN: 12872

East Asian (EAS) AF: 0.147 AC: 3247 AN: 22036

South Asian (SAS) AF: 0.211 AC: 5806 AN: 27550

European-Finnish (FIN) AF: 0.469 AC: 11544 AN: 24610

Middle Eastern (MID) AF: 0.281 AC: 711 AN: 2526

European-Non Finnish (NFE) AF: 0.283 AC: 198045 AN: 700476

Other (OTH) AF: 0.302 AC: 10684 AN: 35370

GnomAD4 genome AF: 0.415 AC: 61467 AN: 148052 Hom.: 13516 Cov.: 0 AF XY: 0.413 AC XY: 29839 AN XY: 72278

African (AFR) AF: 0.392 AC: 15612 AN: 39864

American (AMR) AF: 0.391 AC: 5863 AN: 14988

Ashkenazi Jewish (ASJ) AF: 0.442 AC: 1521 AN: 3442

East Asian (EAS) AF: 0.158 AC: 789 AN: 5000

South Asian (SAS) AF: 0.352 AC: 1650 AN: 4692

European-Finnish (FIN) AF: 0.513 AC: 5243 AN: 10228

Middle Eastern (MID) AF: 0.413 AC: 119 AN: 288

European-Non Finnish (NFE) AF: 0.440 AC: 29329 AN: 66624

Other (OTH) AF: 0.416 AC: 848 AN: 2040

Alfa AF: 0.249 Hom.: 531

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.42
Mutation Taster		=299/1	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs45445694; hg19: chr18-657645; COSMIC: COSV60074424; COSMIC: COSV60074424;