19-10986535-TGGCCCTGGCCCCGGCCCGGGTCCC-T
Variant summary
Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3
The NM_003072.5(SMARCA4):c.708_731delTGGCCCCGGCCCGGGTCCCGGCCC(p.Gly237_Pro244del) variant causes a disruptive inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. P236P) has been classified as Likely benign.
Frequency
Consequence
NM_003072.5 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- Coffin-Siris syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen, Illumina
- intellectual disability, autosomal dominant 16Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
- rhabdoid tumor predisposition syndrome 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Ambry Genetics, Genomics England PanelApp, ClinGen, Labcorp Genetics (formerly Invitae)
- otosclerosisInheritance: AD Classification: STRONG Submitted by: PanelApp Australia
- uterine corpus sarcomaInheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
- familial rhabdoid tumorInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- hereditary nonpolyposis colon cancerInheritance: Unknown Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_003072.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SMARCA4 | MANE Plus Clinical | c.708_731delTGGCCCCGGCCCGGGTCCCGGCCC | p.Gly237_Pro244del | disruptive_inframe_deletion | Exon 4 of 36 | NP_001374212.1 | Q9HBD4 | ||
| SMARCA4 | MANE Select | c.708_731delTGGCCCCGGCCCGGGTCCCGGCCC | p.Gly237_Pro244del | disruptive_inframe_deletion | Exon 4 of 35 | NP_003063.2 | |||
| SMARCA4 | c.708_731delTGGCCCCGGCCCGGGTCCCGGCCC | p.Gly237_Pro244del | disruptive_inframe_deletion | Exon 4 of 36 | NP_001122321.1 | Q9HBD4 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SMARCA4 | MANE Plus Clinical | c.708_731delTGGCCCCGGCCCGGGTCCCGGCCC | p.Gly237_Pro244del | disruptive_inframe_deletion | Exon 4 of 36 | ENSP00000495368.1 | Q9HBD4 | ||
| SMARCA4 | TSL:1 MANE Select | c.708_731delTGGCCCCGGCCCGGGTCCCGGCCC | p.Gly237_Pro244del | disruptive_inframe_deletion | Exon 4 of 35 | ENSP00000343896.4 | P51532-1 | ||
| SMARCA4 | c.708_731delTGGCCCCGGCCCGGGTCCCGGCCC | p.Gly237_Pro244del | disruptive_inframe_deletion | Exon 4 of 35 | ENSP00000493975.1 | A0A2R8Y4P4 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at