rs1555753690

Positions:

• chr19-10986535-TGGCCCTGGCCCCGGCCCGGGTCCC-T
• chr19-10986535-TGGCCCTGGCCCCGGCCCGGGTCCC-TGGCCCTGGCCCCGGCCCGGGTCCCGGCCCTGGCCCCGGCCCGGGTCCC

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_003072.5(SMARCA4):​c.708_731delTGGCCCCGGCCCGGGTCCCGGCCC​(p.Gly237_Pro244del) variant causes a disruptive inframe deletion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: SMARCA4 NM_003072.5 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 6.66

Genes affected

SMARCA4 (HGNC:11100): (SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4) The protein encoded by this gene is a member of the SWI/SNF family of proteins and is similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. In addition, this protein can bind BRCA1, as well as regulate the expression of the tumorigenic protein CD44. Mutations in this gene cause rhabdoid tumor predisposition syndrome type 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]

SMARCA4 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
SMARCA4	NM_001387283.1	c.708_731delTGGCCCCGGCCCGGGTCCCGGCCC	p.Gly237_Pro244del	disruptive_inframe_deletion	4/36	ENST00000646693.2	NP_001374212.1
SMARCA4	NM_003072.5	c.708_731delTGGCCCCGGCCCGGGTCCCGGCCC	p.Gly237_Pro244del	disruptive_inframe_deletion	4/35	ENST00000344626.10	NP_003063.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
SMARCA4	ENST00000646693.2	c.708_731delTGGCCCCGGCCCGGGTCCCGGCCC	p.Gly237_Pro244del	disruptive_inframe_deletion	4/36		NM_001387283.1	ENSP00000495368.1
SMARCA4	ENST00000344626.10	c.708_731delTGGCCCCGGCCCGGGTCCCGGCCC	p.Gly237_Pro244del	disruptive_inframe_deletion	4/35	1	NM_003072.5	ENSP00000343896.4
SMARCA4	ENST00000643549.1	c.708_731delTGGCCCCGGCCCGGGTCCCGGCCC	p.Gly237_Pro244del	disruptive_inframe_deletion	4/35			ENSP00000493975.1
SMARCA4	ENST00000541122.6	c.708_731delTGGCCCCGGCCCGGGTCCCGGCCC	p.Gly237_Pro244del	disruptive_inframe_deletion	5/35	5		ENSP00000445036.2
SMARCA4	ENST00000643296.1	c.708_731delTGGCCCCGGCCCGGGTCCCGGCCC	p.Gly237_Pro244del	disruptive_inframe_deletion	4/34			ENSP00000496635.1
SMARCA4	ENST00000644737.1	c.708_731delTGGCCCCGGCCCGGGTCCCGGCCC	p.Gly237_Pro244del	disruptive_inframe_deletion	4/34			ENSP00000495548.1
SMARCA4	ENST00000589677.5	c.708_731delTGGCCCCGGCCCGGGTCCCGGCCC	p.Gly237_Pro244del	disruptive_inframe_deletion	5/35	5		ENSP00000464778.1
SMARCA4	ENST00000643995.1	c.120_143delTGGCCCCGGCCCGGGTCCCGGCCC	p.Gly41_Pro48del	disruptive_inframe_deletion	1/32			ENSP00000496004.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Rhabdoid tumor predisposition syndrome 2 Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Nov 23, 2020

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant has not been reported in the literature in individuals with SMARCA4-related conditions. ClinVar contains an entry for this variant (Variation ID: 826825). The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the ExAC database. This variant, c.708_731del, results in the deletion of 8 amino acid(s) of the SMARCA4 protein (p.Gly237_Pro244del), but otherwise preserves the integrity of the reading frame. -

Hereditary cancer-predisposing syndrome Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Ambry Genetics

Jun 12, 2024

The c.708_731del24 variant (also known as p.G237_P244del) is located in coding exon 3 of the SMARCA4 gene. This variant results from an in-frame deletion of 24 nucleotides at positions 708 to 731. This results in the deletion of 8 amino acids between codons 237 and 244. This in-frame variant is in a repetitive region of the gene and has no known function or association with disease. In addition, the in silico prediction for this alteration is inconclusive (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Missense and in-frame variants in SMARCA4 are known to cause neurodevelopmental disorders; however, such associations with rhabdoid tumor predisposition syndrome including small cell carcinoma of the ovary-hypercalcemic type (SCCOHT) are exceedingly rare (Kosho T et al. Am J Med Genet C Semin Med Genet. 2014 Sep;166C(3):262-75; Jelinic P et al. Nat Genet. 2014 May;46(5):424-6). Based on the supporting evidence, the association of this alteration with Coffin-Siris syndrome is unknown; however, the association of this alteration with rhabdoid tumor predisposition syndrome is unlikely. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555753690; hg19: chr19-11097211;