19-11113506-G-GCTGATGCCCTTCTCTCCTCCTGCCT

Position:

• chr19-11113506-G-GCTGATGCCCTTCTCTCCTCCTGCCT

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_Moderate PM2

The NM_000527.5(LDLR):​c.1359-27_1359-3dupTGATGCCCTTCTCTCCTCCTGCCTC variant causes a splice acceptor, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: LDLR NM_000527.5 splice_acceptor, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.849

Genes affected

LDLR (HGNC:6547): (low density lipoprotein receptor) The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. The encoded protein is normally bound at the cell membrane, where it binds low density lipoprotein/cholesterol and is taken into the cell. Lysosomes release the cholesterol, which is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2022]

MIR6886 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.08788231 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
LDLR	NM_000527.5	c.1359-27_1359-3dupTGATGCCCTTCTCTCCTCCTGCCTC		splice_acceptor_variant, intron_variant		ENST00000558518.6	NP_000518.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
LDLR	ENST00000558518.6	c.1359-27_1359-3dupTGATGCCCTTCTCTCCTCCTGCCTC		splice_acceptor_variant, intron_variant		1	NM_000527.5	ENSP00000454071.1

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome Cov.: 38

GnomAD4 genome Cov.: 31

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hypercholesterolemia, familial, 1 Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

All of Us Research Program, National Institutes of Health

Jun 26, 2023

This variant causes a duplication of 25 nucleotides in intron 9 of the LDLR gene. To our knowledge, functional studies have not been reported for this variant. This variant has not been reported in individuals affected with LDLR-related disorders in the literature. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr19-11224182;