19-11123307-GCTCACCACGGTGGAGATAGTGACAATGT-GCTCACCACGGTGGAGATAGTGACAATGTCTCACCACGGTGGAGATAGTGACAATGT

Variant names:

• chr19-11123307-G-GCTCACCACGGTGGAGATAGTGACAATGT
• NM_000527.5:c.2282_2309dupCGGTGGAGATAGTGACAATGTCTCACCA

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_000527.5(LDLR):​c.2282_2309dupCGGTGGAGATAGTGACAATGTCTCACCA​(p.Gln770HisfsTer21) variant causes a frameshift, splice region change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: LDLR NM_000527.5 frameshift, splice_region
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 0.315

Genes affected

LDLR (HGNC:6547): (low density lipoprotein receptor) The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. The encoded protein is normally bound at the cell membrane, where it binds low density lipoprotein/cholesterol and is taken into the cell. Lysosomes release the cholesterol, which is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2022]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 19-11123307-G-GCTCACCACGGTGGAGATAGTGACAATGT is Pathogenic according to our data. Variant chr19-11123307-G-GCTCACCACGGTGGAGATAGTGACAATGT is described in ClinVar as [Pathogenic]. Clinvar id is 1452737.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
LDLR	NM_000527.5	c.2282_2309dupCGGTGGAGATAGTGACAATGTCTCACCA	p.Gln770HisfsTer21	frameshift_variant, splice_region_variant	Exon 15 of 18	ENST00000558518.6	NP_000518.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
LDLR	ENST00000558518.6	c.2282_2309dupCGGTGGAGATAGTGACAATGTCTCACCA	p.Gln770HisfsTer21	frameshift_variant, splice_region_variant	Exon 15 of 18	1	NM_000527.5	ENSP00000454071.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 34

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Familial hypercholesterolemia Pathogenic:1

Dec 08, 2020

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Gln770Hisfs*21) in the LDLR gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in LDLR are known to be pathogenic (PMID: 20809525, 28645073). This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with LDLR-related conditions. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr19-11233983;