rs1555808143

Variant names:

• chr19-11123307-GCTCACCACGGTGGAGATAGTGACAATGT-G
• rs1555808143
• NM_000527.5:c.2282_2309delCGGTGGAGATAGTGACAATGTCTCACCA

Your query was ambiguous. Multiple possible variants found:

• chr19-11123307-GCTCACCACGGTGGAGATAGTGACAATGT-G
• chr19-11123307-GCTCACCACGGTGGAGATAGTGACAATGT-GCTCACCACGGTGGAGATAGTGACAATGTCTCACCACGGTGGAGATAGTGACAATGT

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_000527.5(LDLR):​c.2282_2309delCGGTGGAGATAGTGACAATGTCTCACCA​(p.Thr761LysfsTer18) variant causes a frameshift, splice region change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. T761T) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: LDLR NM_000527.5 frameshift, splice_region
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 4.55
• Publications: 0 publications found

Genes affected

LDLR (HGNC:6547): (low density lipoprotein receptor) The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. The encoded protein is normally bound at the cell membrane, where it binds low density lipoprotein/cholesterol and is taken into the cell. Lysosomes release the cholesterol, which is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2022]

LDLR Gene-Disease associations (from GenCC):

• hypercholesterolemia, familial, 1

  Inheritance: AD, SD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine, ClinGen
• homozygous familial hypercholesterolemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 19-11123307-GCTCACCACGGTGGAGATAGTGACAATGT-G is Pathogenic according to our data. Variant chr19-11123307-GCTCACCACGGTGGAGATAGTGACAATGT-G is described in ClinVar as Pathogenic. ClinVar VariationId is 441230.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000527.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LDLR	NM_000527.5	MANE Select	c.2282_2309delCGGTGGAGATAGTGACAATGTCTCACCA	p.Thr761LysfsTer18	frameshift splice_region	Exon 15 of 18	NP_000518.1
	LDLR	NM_001195798.2		c.2282_2309delCGGTGGAGATAGTGACAATGTCTCACCA	p.Thr761LysfsTer18	frameshift splice_region	Exon 15 of 18	NP_001182727.1
	LDLR	NM_001195799.2		c.2159_2186delCGGTGGAGATAGTGACAATGTCTCACCA	p.Thr720LysfsTer18	frameshift splice_region	Exon 14 of 17	NP_001182728.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LDLR	ENST00000558518.6	TSL:1 MANE Select	c.2282_2309delCGGTGGAGATAGTGACAATGTCTCACCA	p.Thr761LysfsTer18	frameshift splice_region	Exon 15 of 18	ENSP00000454071.1
	LDLR	ENST00000252444.10	TSL:1	c.2540_2567delCGGTGGAGATAGTGACAATGTCTCACCA	p.Thr847LysfsTer18	frameshift splice_region	Exon 15 of 18	ENSP00000252444.6
	LDLR	ENST00000558013.5	TSL:1	c.2282_2309delCGGTGGAGATAGTGACAATGTCTCACCA	p.Thr761LysfsTer18	frameshift splice_region	Exon 15 of 18	ENSP00000453346.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Hypercholesterolemia, familial, 1 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.6
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555808143; hg19: chr19-11233983;