19-13024682-TGTGTGTGTGGACGGCAACGTTGTCTGTGCGC-T

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1PM2

The NM_001378405.1(NFIX):​c.48_75+3delGACGGCAACGTTGTCTGTGCGCGTGTGTGTG​(p.Thr17MetfsTer47) variant causes a frameshift, splice donor, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

NFIX
NM_001378405.1 frameshift, splice_donor, splice_region, intron

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 4.59
Variant links:
Genes affected
NFIX (HGNC:7788): (nuclear factor I X) The protein encoded by this gene is a transcription factor that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral and cellular promoters. The encoded protein can also stimulate adenovirus replication in vitro. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 10 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 52 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
NFIXNM_001365902.3 linkc.28-329_28-299delGACGGCAACGTTGTCTGTGCGCGTGTGTGTG intron_variant Intron 1 of 10 ENST00000592199.6 NP_001352831.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
NFIXENST00000592199.6 linkc.28-329_28-299delGACGGCAACGTTGTCTGTGCGCGTGTGTGTG intron_variant Intron 1 of 10 5 NM_001365902.3 ENSP00000467512.1 Q14938-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Marshall-Smith syndrome;C3553660:Malan overgrowth syndrome Uncertain:1
Nov 24, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This sequence change falls in intron 1 of the NFIX gene. It does not directly change the encoded amino acid sequence of the NFIX protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with NFIX-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the effect of this variant on mRNA splicing is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr19-13135496; API