19-13024682-TGTGTGTGTGGACGGCAACGTTGTCTGTGCGC-T

Variant names:

• chr19-13024682-TGTGTGTGTGGACGGCAACGTTGTCTGTGCGC-T
• NM_001365902.3:c.28-329_28-299delGACGGCAACGTTGTCTGTGCGCGTGTGTGTG

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_001378405.1(NFIX):​c.48_75+3delGACGGCAACGTTGTCTGTGCGCGTGTGTGTG​(p.Thr17MetfsTer47) variant causes a frameshift, splice donor, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: NFIX NM_001378405.1 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 4.59

Genes affected

NFIX (HGNC:7788): (nuclear factor I X) The protein encoded by this gene is a transcription factor that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral and cellular promoters. The encoded protein can also stimulate adenovirus replication in vitro. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 52 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
NFIX	NM_001365902.3	c.28-329_28-299delGACGGCAACGTTGTCTGTGCGCGTGTGTGTG		intron_variant	Intron 1 of 10	ENST00000592199.6	NP_001352831.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
NFIX	ENST00000592199.6	c.28-329_28-299delGACGGCAACGTTGTCTGTGCGCGTGTGTGTG		intron_variant	Intron 1 of 10	5	NM_001365902.3	ENSP00000467512.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Marshall-Smith syndrome;C3553660:Malan overgrowth syndrome Uncertain:1

Nov 24, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change falls in intron 1 of the NFIX gene. It does not directly change the encoded amino acid sequence of the NFIX protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with NFIX-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the effect of this variant on mRNA splicing is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr19-13135496;