19-13135342-GGCCGTGCTTGCTGCCAGCAGCTCCTACTTCCGGGACCTGTTCAACAACAGCCGCAGC-G

Position:

• chr19-13135342-GGCCGTGCTTGCTGCCAGCAGCTCCTACTTCCGGGACCTGTTCAACAACAGCCGCAGC-G

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2 PM4 PP3

The NM_052876.4(NACC1):​c.142_198delCTTGCTGCCAGCAGCTCCTACTTCCGGGACCTGTTCAACAACAGCCGCAGCGCCGTG​(p.Leu48_Val66del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000000684 in 1,461,322 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
• Consequence: NACC1 NM_052876.4 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 9.87

Genes affected

NACC1 (HGNC:20967): (nucleus accumbens associated 1) This gene encodes a member of the BTB/POZ protein family. BTB/POZ proteins are involved in several cellular processes including proliferation, apoptosis and transcription regulation. The encoded protein is a transcriptional repressor that plays a role in stem cell self-renewal and pluripotency maintenance. The encoded protein also suppresses transcription of the candidate tumor suppressor Gadd45GIP1, and expression of this gene may play a role in the progression of multiple types of cancer. A pseudogene of this gene is located on the short arm of chromosome 9. [provided by RefSeq, Feb 2012]

ACMG classification

Verdict is Uncertain_significance. Variant got 5 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_052876.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
NACC1	NM_052876.4	c.142_198delCTTGCTGCCAGCAGCTCCTACTTCCGGGACCTGTTCAACAACAGCCGCAGCGCCGTG	p.Leu48_Val66del	conservative_inframe_deletion	2/6	ENST00000292431.5	NP_443108.1
NACC1	XM_005259721.4	c.142_198delCTTGCTGCCAGCAGCTCCTACTTCCGGGACCTGTTCAACAACAGCCGCAGCGCCGTG	p.Leu48_Val66del	conservative_inframe_deletion	3/7		XP_005259778.1
NACC1	XM_047438118.1	c.142_198delCTTGCTGCCAGCAGCTCCTACTTCCGGGACCTGTTCAACAACAGCCGCAGCGCCGTG	p.Leu48_Val66del	conservative_inframe_deletion	2/6		XP_047294074.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
NACC1	ENST00000292431.5	c.142_198delCTTGCTGCCAGCAGCTCCTACTTCCGGGACCTGTTCAACAACAGCCGCAGCGCCGTG	p.Leu48_Val66del	conservative_inframe_deletion	2/6	1	NM_052876.4	ENSP00000292431.3
NACC1	ENST00000586171.3	c.142_198delCTTGCTGCCAGCAGCTCCTACTTCCGGGACCTGTTCAACAACAGCCGCAGCGCCGTG	p.Leu48_Val66del	conservative_inframe_deletion	3/7	5		ENSP00000467120.2
NACC1	ENST00000700232.1	c.142_198delCTTGCTGCCAGCAGCTCCTACTTCCGGGACCTGTTCAACAACAGCCGCAGCGCCGTG	p.Leu48_Val66del	conservative_inframe_deletion	2/6			ENSP00000514870.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 6.84e-7 AC: 1 AN: 1461322 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 726978

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 8.99e-7

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jan 10, 2024

This variant, c.142_198del, results in the deletion of 19 amino acid(s) of the NACC1 protein (p.Leu48_Val66del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with NACC1-related conditions. ClinVar contains an entry for this variant (Variation ID: 1384103). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr19-13246156;