19-13317145-AGTGAACAATAGCAACACACAGC-A
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_001127222.2(CACNA1A):c.1500_1521delGCTGTGTGTTGCTATTGTTCAC(p.Leu501ThrfsTer19) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. T500T) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_001127222.2 frameshift
Scores
Clinical Significance
Conservation
Publications
- episodic ataxia type 2Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
- undetermined early-onset epileptic encephalopathyInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, Illumina
- developmental and epileptic encephalopathy, 42Inheritance: AD Classification: STRONG, MODERATE Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- migraine, familial hemiplegic, 1Inheritance: AD Classification: STRONG Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
- spinocerebellar ataxia type 6Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet
- benign paroxysmal torticollis of infancyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- familial or sporadic hemiplegic migraineInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Lennox-Gastaut syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001127222.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CACNA1A | NM_001127222.2 | MANE Select | c.1500_1521delGCTGTGTGTTGCTATTGTTCAC | p.Leu501ThrfsTer19 | frameshift | Exon 11 of 47 | NP_001120694.1 | ||
| CACNA1A | NM_001127221.2 | MANE Plus Clinical | c.1503_1524delGCTGTGTGTTGCTATTGTTCAC | p.Leu502ThrfsTer19 | frameshift | Exon 11 of 47 | NP_001120693.1 | ||
| CACNA1A | NM_023035.3 | c.1503_1524delGCTGTGTGTTGCTATTGTTCAC | p.Leu502ThrfsTer19 | frameshift | Exon 11 of 48 | NP_075461.2 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CACNA1A | ENST00000360228.11 | TSL:1 MANE Select | c.1500_1521delGCTGTGTGTTGCTATTGTTCAC | p.Leu501ThrfsTer19 | frameshift | Exon 11 of 47 | ENSP00000353362.5 | ||
| CACNA1A | ENST00000638009.2 | TSL:1 MANE Plus Clinical | c.1503_1524delGCTGTGTGTTGCTATTGTTCAC | p.Leu502ThrfsTer19 | frameshift | Exon 11 of 47 | ENSP00000489913.1 | ||
| CACNA1A | ENST00000638029.1 | TSL:5 | c.1503_1524delGCTGTGTGTTGCTATTGTTCAC | p.Leu502ThrfsTer19 | frameshift | Exon 11 of 48 | ENSP00000489829.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
not provided Pathogenic:2
The c.1503_1524del22 variant in the CACNA1A gene has not been reported previously as a pathogenic variant, nor as a benign variant, to our knowledge. The c.1503_1524del22 variant causes a frameshift starting with codon Leucine 502, changes this amino acid to a Threonine residue, and creates a premature Stop codon at position 19 of the new reading frame, denoted p.Leu502ThrfsX19. This variant is predicted to cause loss of normal protein function either through protein truncation or nonsense-mediated mRNA decay. The c.1503_1524del22 variant is not observed in large population cohorts (Lek et al., 2016). We interpret c.1503_1524del22 as a likely pathogenic variant.
Episodic ataxia type 2;C4310716:Developmental and epileptic encephalopathy, 42 Pathogenic:1
For these reasons, this variant has been classified as Pathogenic. While this particular variant has not been reported in the literature, loss-of-function variants in CACNA1A are known to be pathogenic (PMID: 14718690, 10371528). This sequence change deletes 22 nucleotides from exon 11 of the CACNA1A mRNA (c.1503_1524del), causing a frameshift at codon 502. This creates a premature translational stop signal (p.Leu502Thrfs*19) and is expected to result in an absent or disrupted protein product.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at