19-13906487-GCGGCCGCCCGCCAGGTGAGTTTGCGCCCCACGGCC-G

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_017721.5(CC2D1A):​c.49_60+23delGCCGCCCGCCAGGTGAGTTTGCGCCCCACGGCCCG​(p.Ala17_Gln20del) variant causes a splice donor, conservative inframe deletion, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

Frequency

Genomes: not found (cov: 32)

Consequence

CC2D1A
NM_017721.5 splice_donor, conservative_inframe_deletion, splice_region, intron

Scores

Not classified

Clinical Significance

Likely pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 4.05
Variant links:
Genes affected
CC2D1A (HGNC:30237): (coiled-coil and C2 domain containing 1A) This gene encodes a transcriptional repressor that binds to a conserved 14-bp 5'-repressor element and regulates expression of the 5-hydroxytryptamine (serotonin) receptor 1A gene in neuronal cells. The DNA binding and transcriptional repressor activities of the protein are inhibited by calcium. A mutation in this gene results in a nonsyndromic form of cognitive disability (MRT3). [provided by RefSeq, Jul 2017]
BRME1 (HGNC:28153): (break repair meiotic recombinase recruitment factor 1) Predicted to be involved in meiosis I and spermatogenesis. Predicted to be located in chromosome. [provided by Alliance of Genome Resources, Apr 2022]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 19-13906487-GCGGCCGCCCGCCAGGTGAGTTTGCGCCCCACGGCC-G is Pathogenic according to our data. Variant chr19-13906487-GCGGCCGCCCGCCAGGTGAGTTTGCGCCCCACGGCC-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 2750986.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
CC2D1ANM_017721.5 linkuse as main transcriptc.49_60+23delGCCGCCCGCCAGGTGAGTTTGCGCCCCACGGCCCG p.Ala17_Gln20del splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant 1/29 ENST00000318003.11 NP_060191.3 Q6P1N0-1

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
CC2D1AENST00000318003.11 linkuse as main transcriptc.49_60+23delGCCGCCCGCCAGGTGAGTTTGCGCCCCACGGCCCG p.Ala17_Gln20del splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant 1/291 NM_017721.5 ENSP00000313601.6 Q6P1N0-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Likely pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not provided Pathogenic:1
Likely pathogenic, criteria provided, single submitterclinical testingLabcorp Genetics (formerly Invitae), LabcorpAug 07, 2023In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. This variant has not been reported in the literature in individuals affected with CC2D1A-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant results in the deletion of part of exon 1 (c.49_60+23del) of the CC2D1A gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in CC2D1A are known to be pathogenic (PMID: 16033914). -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr19-14017300; API