NM_017721.5:c.49_60+23delGCCGCCCGCCAGGTGAGTTTGCGCCCCACGGCCCG

Variant names:

• chr19-13906487-GCGGCCGCCCGCCAGGTGAGTTTGCGCCCCACGGCC-G
• NM_017721.5:c.49_60+23delGCCGCCCGCCAGGTGAGTTTGCGCCCCACGGCCCG

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_017721.5(CC2D1A):​c.49_60+23delGCCGCCCGCCAGGTGAGTTTGCGCCCCACGGCCCG​(p.Ala17_Gln20del) variant causes a splice donor, conservative inframe deletion, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. A17A) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CC2D1A NM_017721.5 splice_donor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 4.05
• Publications: 0 publications found

Genes affected

CC2D1A (HGNC:30237): (coiled-coil and C2 domain containing 1A) This gene encodes a transcriptional repressor that binds to a conserved 14-bp 5'-repressor element and regulates expression of the 5-hydroxytryptamine (serotonin) receptor 1A gene in neuronal cells. The DNA binding and transcriptional repressor activities of the protein are inhibited by calcium. A mutation in this gene results in a nonsyndromic form of cognitive disability (MRT3). [provided by RefSeq, Jul 2017]

BRME1 (HGNC:28153): (break repair meiotic recombinase recruitment factor 1) Predicted to be involved in meiosis I and spermatogenesis. Predicted to be located in chromosome. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
• PP5: Variant 19-13906487-GCGGCCGCCCGCCAGGTGAGTTTGCGCCCCACGGCC-G is Pathogenic according to our data. Variant chr19-13906487-GCGGCCGCCCGCCAGGTGAGTTTGCGCCCCACGGCC-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 2750986.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CC2D1A	NM_017721.5	c.49_60+23delGCCGCCCGCCAGGTGAGTTTGCGCCCCACGGCCCG	p.Ala17_Gln20del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 1 of 29	ENST00000318003.11	NP_060191.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CC2D1A	ENST00000318003.11	c.47_60+21delCGGCCGCCCGCCAGGTGAGTTTGCGCCCCACGGCC	p.Ala17ValfsTer9	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 1 of 29	1	NM_017721.5	ENSP00000313601.6

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Aug 07, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant results in the deletion of part of exon 1 (c.49_60+23del) of the CC2D1A gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in CC2D1A are known to be pathogenic (PMID: 16033914). In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. This variant has not been reported in the literature in individuals affected with CC2D1A-related conditions. This variant is not present in population databases (gnomAD no frequency). -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.1

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr19-14017300;